Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y37D8A.18   

sjj_Y37D8A.18 RNAi JA:Y37D8A.18
Simmer:Y37D8A.18
PCR_productsjj_Y37D8A.18
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37D8A.18 Source_evidenceePCR468WS150 Sequence/Annotation Release
Overlaps_Gene Y37D8A.18 Source_evidenceePCR468WS150 Sequence/Annotation Release
Chunk_score Abs_score405
Max_abs_score405Y37D8A.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1292562712927298
Overlaps_transcriptY37D8A.18 Source_evidenceePCR468WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y37D8A.181672aacaaaaattaaggcaacgcatattgaaaatcaaaagaaaacaccagcggtttctatggaaatcaattaacgagtatgtggagccgcagagcacacattctcgataatacttgagaacgaccgcaaacactttgacggcacgttgcacagaaaatatttttgtgattttttactttatttactcataataatcgttttaaactgcttttatcggatataaattcataaatttgaagaaaaactgcagaatttctctagctagaaataaaaaataaaattaattgtcgtcaagttgtgcgcattgtacgcaagcagcgtgacgtcagattgcacagttttcttttttatataaaaaatttaatttaatcttttttaaaatcaaatttccgctattcaaatagattttaagagcttattttaaaataaattaaaatttcctgaatttcagaatgctaaaactcgcttcatccctcagaactggtcttataagccgaagcatccgaacattagcgccaacagtgaacccggccgagcaacagcaagttcaagcagttttacccgacaaactgtacagctcagttgaaatcgagtatcgtgggcacgacaaggcggttttgaagtcatatacgtcgtttttgcaggtatttgaacgtttttcaggtctttttgattttaaattgcatttttcatttattttcagcaagtctgccaacacctggagattcctcaaggtcgtctcgaagttcttccgtatattcgatgggttcagccggctctgcgctcgaaattcgtccataaaaaatataaattgcattatgagacgagaacacacatttctaaacttgaggttggaaaataattaaacgcctatggggtcacaataaccgaatatcatgataaaaaaattcaaaaaaattttctagattttatatgattttttgaaaattagaaaaatctcagttttccccctaattcctaattgaatttccgccaattggattcgttcggtggagcgcacttgctatattttcattaatttattttattttttctcattctttcactgattttcttcaatatttgcgtatttttatcggaaaaagagagaaaaatgcaagataaaatcaaattgttcattaaaaatcactgaaaatgggtaaaactctaaaattatgagttctggagacaacaagctagcttgaaattagcatattttacagttttacccattttcagtattttttttttatgaagaatttgcatttttctctctttttccgataaaaaaccacaaatattgaagaaaatcagtgaaataatgagaaaaaataaaataaaatcaataaaaatagagcaagtgcgctccaccgaacaagttcaattagcggtaatttaaataggaattaggggaagggaagaaagagattttttcaattttcaaaaaatcatataaagtcaggaacatttttttgaatttttttatcatgatattcggtctctgtgaccccaaaggcgtgttttcaccttaaatttttttttccagatcctcaacgtgactggctccacagcttcaacattcctcgaatacatccaacgaaacatcccagaaggcgtcggaatgcgtgtcggattcaccgaacttcaaccactaccgctgacaattcagaaaaat