Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y37H2C.3   

sjj_Y37H2C.3RNAiJA:Y37H2C.3
PCR_productsjj_Y37H2C.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37H2C.3 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene Y37H2C.3 Source_evidenceePCR899WS150 Sequence/Annotation Release
Chunk_score Abs_score815
Max_abs_score815Y37H2C.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1826999418271122
Overlaps_transcriptY37H2C.3 Source_evidenceePCR899WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y37H2C.31129gaaaaactggccgatctcaattaaattataatgcataaagttgagaactgcaacttcaaatgtgctagattccatgagaatctgttaaatatatgtgtagttggaatatgattgttctaagcttacatctcgaattttgatcaactcctctgttgtcagtataaccaacctgacgatgcagcttgtcaagtgcaagaagctatcaatagggatgttcataaagatatcgcctatcacatcaaacttttccagatgtttccattgctccaattccacaatattctgaagtgggactgtatccggacgagatcgaagtacgaactgatatggtttggtgaacctaattgagacttctttcagagtaccagattttgttaatcgtactatcgaaactatttcctcacagcgaatgtcgatgaattgcaggctggtgaccaacaatggactcacttttgccagctcgataggaatgctctcggagcccgcgaaaagtacaccccaggcttgctgagtctcggtgataaccagagtgtcaagtgtgaaaaatgggcttttgagaatactcgacagcgtcatgatggccaagctcaggttatttgatttttccattgctccgccattttccacgagacgcccgttttcataaagaccaactatagagtctgtacgattcagaaaggtgtagatcattgaatgagtgggggataacgttaggatggtgttgaagtatcccgcggaaagagtgatcgtcttgaagttccagtccagggagtcgatggcgttgcggaacacgctgcagacacggcggaaggggaatctagaattcgggcaagttttggcgtgtttttgaagcttggttcagaattttgttgccgaaaattcttgttcgtaggcctgctacaatttaaacgcgcaatttcagcaggatagatcatagggctcaaagtgcgctgctcaccgttcaatcggctcaatttccatcaaaatcttccgtacaatctcaaccggcatggtcgagagctgaagagcattcggatcaaacctgcagcatcaatattaagagagatattcaaaaaattaaccaacttctctccactgtccagctccaattccccctttccaagcttat