Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y38C1BA.c   

sjj_Y38C1BA.cRNAiJA:Y38C1BA.c
PCR_productsjj_Y38C1BA.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y38C1BA.2a Source_evidenceePCR776WS150 Sequence/Annotation Release
Y38C1BA.2b Source_evidenceePCR776WS150 Sequence/Annotation Release
Overlaps_Gene Y38C1BA.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score713
Max_abs_score713Y38C1BA.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV18062191808438
Overlaps_transcript Y38C1BA.2b Source_evidenceePCR776WS150 Sequence/Annotation Release
Y38C1BA.2a Source_evidenceePCR776WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y38C1BA.c2220cgtcacccacctataacatcattaacgtcatgcacaaactcccgtccctccttcgaaacgagaatgtcaatggagcatatatgcattggtcccacgtgatccgtgatggctttcaggtactttttgtgcctctcacacgtggaaatttgctccaaaacgctggagccaacgttgctcttccagtgtttgcagattccacggcgaatgaaggttttgtactcgtggcctattttttggatgtgaaggtcgtacttggcgtcgacgaacggttgcacttccacctggaaaataatgtcatacatttaaaaaaaaatccctgaaatttaaatttgttaaaatattttctttctatgtttagagacctagtaaagttttgaaatgtaattttgaaccttcaaaatattcaaaaatctttcaaatttgccgcccacctcggtatcgcctttgctcataatttggagcattccctcgacgtcgcacagctcctcgtgattgttcactttgatttttccgattccctggaatccctcgttcactgagacaaccatcgggtaagtcgacgattggctttggtgctggaaaaaatttgtcttgatttttgaaggtaaagttcaaatttctaatatattttgatgagtactcaatttttggaaaaagttcgaaaattttataattttttgaaaagcctaaagcttaaaattgtgcatgattttcagtcgatttttttaaatttttatttgaattttatttgtctgttttcaatttttcataatttttcgacttttaccaaaaccaaaaagaaattgtagaaatctttcgaacaacaaatttttttaagtaatttcgcttattttctcatttttttaaacttgaaatatcaaaacattcatcgatttttcttcaacttttctaaaaaagaagctttatgggatgatgcaagtgaatttttctacatttctcgacaattttttgcaatgcaagtaagcagcgaaatgacgcgaaattcgcaatttttttacatttttttacaatttttttacatttctctacatttctcgacatgggaaaaaacactcattttttgtcaaaaccacgttagttcacgactttacctttccagacgttcacgtttgttaaaagtagtgtaaaatgggaaaaataaaataatttgacaattttaaaagatatatgcgtgttgcaaaacagacaaatatgaaaaatcaaacttgatcatttttaaattttagaattcaaaaccacgttgtgtggccacgcatatatcttttaaaattgtcaaattattttatttttcccattttacactacttttaacaaacgtgaacgtctgaaaaggtaaagtcgtgaactaaagacgtggttttgacaaaaaatgagtgttttttcccatgtcgagaaatgtagagaaatgtaaaaaaattgttaaaaaatgttaaaaaattgcgaatttcgcgtcattttgctgcttacttgcattgcaaaaaaattgtcgattttttagaaaaaactaaaaaaataaaaaatatatatataactgaaaactgaacaatcaaaaataatataatttctacttttttttgtactcaataaataactacaacatcggataggttttcaattttttcaatttttctgagacaaaaaaccaggaaaaaagttttttggtttgatccttttaaaaattaacaaaaaaatcgaaaaaaaagccaaaatattttttttaacctaaaaatcgaaaaggtttgattttctgtgattaaatttgattttaaaaacgtctttttaattttaaaattaaacaaatattttcgaaaaataaaaaaatcgagccaaaaactcacaaatttatgaaaatgcggataatgaacaataggaagcattgggatcgatgcaccatcagacaatgtaatctttttcaactgcttcttcagattattccgatccaaaaacgctaccgcagaggtatgggagttcagaaatggaatatgagcagctataaatgctcgagtgattgtcttcaactgagcacatcgagttgctccggctcccagaaaaactgcggatggggtgaacgttcggacgtcttttcccggtgtgttcagctcgactgtgcagtttttctcggtgcacattacgtcaagctcgtcgatgtctccttgctccacgcggattgcatattctgtgtgattgcggaaatatttt