Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y38H8A.4   

sjj_Y38H8A.4RNAiJA:Y38H8A.4
PCR_productsjj_Y38H8A.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY38H8A.4 Source_evidenceePCR744WS150 Sequence/Annotation Release
Overlaps_Gene Y38H8A.4 Source_evidenceePCR744WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662Y38H8A.4
Specificity_index0.769
Rel_score1
Map_statusUnique_ePCRIV1347072713471921
C27D6.11 Chunk_score Abs_score199
Specificity_index0.231
Rel_score0.301
Overlaps_transcriptY38H8A.4 Source_evidenceePCR744WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y38H8A.41195attccgattcacaaattgccttgtaagttggtcgatttggagcatgaggctgaagaatctccaaaatcagagccttggaatgaatggaggctgtacaggtttttccgaatcttgaacgaaattcaaatttaaaaaaaaacggtttctagtacattttacttacttaattttatgagccagttgtctctcaatcattctcgtcggatcgcgatcatcaaacggcatggttccaaccaacataatgtacaaaatcactccggtactccagacatcaaccgcatttcccgaatattctcttccgcgcagaatctccggagcaacatacgcacgagatccgcagaatgttccagacttctctccaggtttcaggatacgcgagaagccaaaatctccgagtttgacgttctcgtacttgtcaagaaagatgttctcgcacttgaggtcacggtgcacaatgttatatgattggagatgctgaaaatgtaaagttcagagtatttgaaatgtttagtaatctgaaatgacgtcaaatttctctttaaaaaattgccgctatttctggagatcaaaaaggtgatgctaacgatgtcggtgtaccggaattcacaaaatcttacgcgcatttagtaaaagtcgtggtataccgtatacgtatacggtagataaattgcgaacagttaatccgaccctgtttctgagggaaatttcagaaaactaaccatgagagctgcgatgaactgacggaaggtgaacttcgcgttctcttcactcattgtcttgatcttcttcatttttcgaagcaagtctcctccagcacaaaactcggtgacaaaaatgatatgatcagggaaggagatcatttcatacaaacggcagacgttgtcatgtttcagaagcttcacaatctccttctcacgtggcaagaacttcttgatgtagtcatctttttcacgggtcggagtgatgttgatcaccttcgccgccacttcaagcttcttatcgccccacgtggcacgggccactcgagagtacgatccgctgcctggaaatttagaaattaagtaagtttataaatttaattgttcagcaaagtctccagctcatttttgaaggaagttatgagcgtttgaagttgacagtgtggaagaggaaaatagtgtggagaaaggagagaggggaaaagacagagcgtctg