Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39B6A.f   

sjj_Y39B6A.f RNAi JA:Y39B6A.f
Simmer:Y39B6A.f:Repeat_a
Simmer:Y39B6A.f:Screen
PCR_productsjj_Y39B6A.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39B6A.36 Source_evidenceePCR635WS150 Sequence/Annotation Release
Overlaps_Gene Y39B6A.36 Source_evidenceePCR640WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598Y39B6A.36
Specificity_index0.781
Rel_score1
Map_statusUnique_ePCRV1899647818998264
Y71H2AM.2 Chunk_score Abs_score97
Specificity_index0.127
Rel_score0.162
F45H10.1 Chunk_score Abs_score71
Specificity_index0.093
Rel_score0.119
Overlaps_transcriptY39B6A.36 Source_evidenceePCR640WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39B6A.f1787ccacctattttcccctgtaaaactctcgattctccaggaaaatgagcccaacgaagcgatattcgaatgacgtcgactgtgagctggcaaaacggagcatttggcttgtaaaagtgcccagatatttgtcagagctctgggatgccaacgagggaaatgttgttggaaaattgcagattggagcgcaggtaaaattggaaaaaatattgaaaatcctgttgaaaatgctgaaaatgaagtttttggcccaaaaatagtgtggaaaatcggaaaaatctgaaattctggtcaaaaatgtgattttcaaaggaaaaaacatcgattaaatcataaaagatatgaaatttgggaaaaaattcaaaaataaggtagaaccgtcgttttttggacagaaaaatacctcaggttttcaaatgaaaaaaatctgaaaaatgtggaaaacggcatttaattttcaatttaatgacatttttcctcgaaaatctgaatttttgtctcaaaaattgacaaaaatcgattttttgccggaaaaactggataattccactgaaaatttgacatttaaccaatttttctgtgttttacataaaaatgcactgaagaagaaccaagaaattcgaaattctactgaaaatgcggaaaaattcgaaattattttaagaaaattaaattttaactgcttttttaaactcaaaatttgaaattttctgctaaaaattcaattttgatcaaaaaagcctgaatttctcaccgaaaaatgaaattttctgaaaaaattgaaaaaaaaaatacaccagaagcttagaaaatcgatttttcaatgaaattttcagtggaattaattgtttttcggttgaaaatcgatttttcaagttaaaacgctagttttacagtgaaaaatgctcatttttagagttttttcacgggaaaaatgcttaaattaggacatttttctccgaaaactgaatttttggtttaaaaatttaaatttcaggtcgagcttcacaccgccaaaggtctcattcatcccaaaccaaaagagcccacagagggctcatcatctacagtaacccaaccagaagcctcggaaattccaacagaatactcatttattcttcatgacgtcaaatctcaaacaatgagcgttttatccgaagataagcagggactcggtgcagatgctccaatcaaaactggaaaactggcaattgagggacgaattatcaaaaaagcggaatgtcggccaccggccacgtcgaaatatatgaaaatgaagttggcacatattgtgaaaaatactcaaccaaagaaaacggttaaaatgattgaaaaagcggctgtgaagtttaagcccgtgtctgtacatgctgaagatatgattaagagcaaacagaagaaggatggagctaaaacttatcgagctgatagagatgtgctccgtggagctcttttcaaagcttttgagaagcatagtttttataggtaaaatactcgagaaaactacggaaaatttgtgttgttttggcctttttcactgcaactttttcctcacgagggacgaggaaaagtggtttctaggccatggccgaggggaagacaaatttcagcggccatttatcttgctttgttttccgcctgttttctttcgtttttcatcgatttttttcgttttttcttaataaaactgataaataaatattttttgcagatgccaaaacgatttccaagtaaaaaaaagtgtattcagtgggcaagcagcggtgaaagtgggcattgtaatatgatgg