Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_236.d   

sjj_Y39G10A_236.dRNAiJA:Y39G10A_236.d
PCR_productsjj_Y39G10A_236.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W03F11.6a Source_evidenceePCR62WS150 Sequence/Annotation Release
W03F11.6c Source_evidenceePCR62WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR62WS150 Sequence/Annotation Release
Overlaps_GeneW03F11.6 Source_evidenceePCR62WS150 Sequence/Annotation Release
Overlaps_transcript W03F11.6c Source_evidenceePCR62WS150 Sequence/Annotation Release
W03F11.6a Source_evidenceePCR62WS150 Sequence/Annotation Release
W03F11.6d Source_evidenceePCR62WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_236.d1138atatcaataacgcaccaaaatggcaatagacggcaattaccagcccccgtgagccaccatagcaagttttgaaaaatgattcttgtagccactattctcaaataccatttagcgtttatttcatatcgatatcccgcacagttttaacgtcattcccttgtgagctaagtcgttatctcttctctacgtcgtttccgatttttctcccaaatttcctatccgaaagtctccagtctccagaaaaaaaaatgcgtcgagtcaactcggaatctcgtctccacaaaacagaaaccacatttggagtcggttcttcttctccaaccatcccatcatcttatgcacttcccagacaccaacaaacttctcgttatatctatcatcgccgagcagcatccacagatgctgagcccctcctcgcatcgtttgatgcacctgtgccccgaccccgtcgggtcactttttcgcagacatctgcggcaaagccaccgccgccagttccgatacccgtcacgaggtttcagacggctgcacctgctgcgaatttcagtgctagacagcttaaacatctgtaagattggcttcagagttgcactttttttggtggaaaatttttaaatttattttctgaaaaagttataaaaattgaaaaaaaattaatttccagcatgtccggctcatcagtctcatcatcacggcaggaggatcttatgatgcattccaataatagtgagtttttttttgttggaaaattgacatcgatgcaccatgtatcaaaattggctaattttggaaacaccttgggttactgtagctgaatgtttcctgaaaagtcttaaacttcagttttaaaacttcaagacatggtgcattaagagtcttaatttaagacatggtacactgatacaaaattaaaaaaaaataggccaatttcctggaaacccccaaaaattgtccaatttttctaaggcttaatgacggaaattttacaattttcacggtttttgagttatatcggcaaaaaaatggacgatttacgaacttttaatacaaatttactatatattcagtatcttccctaataacttaaacatttttttgttggaaaattgaaattgatgcaccatgtattaaaattggc