Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_240.a   

sjj_Y39G10A_240.aRNAiJA:Y39G10A_240.a
PCR_productsjj_Y39G10A_240.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y39G10AR.11 Source_evidenceePCR2077WS150 Sequence/Annotation Release
Chunk_score Abs_score2056
Max_abs_score2056Y39G10AR.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22931362295213
Overlaps_transcript Y39G10AR.11.2 Source_evidenceePCR2077WS150 Sequence/Annotation Release
Y39G10AR.11.1 Source_evidenceePCR2077WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_240.a2078gaaaactcaacgcttcacactctttacactgccccgtctccttggcagttgaagagcatcatcctatccgcagatctccaaaatgtctcagcagcaggaacttcccacctatcagcagactagcagctcacttgagcgtcgagtgaccgagcttcaggatgagaataagagtcttcgactgacgttggctcttcgcactgactgtgagcacgagctagaacgagttcgcaatgagacgcatccgggagttgaggagctcgagaagaagctcgccagtgctgagaacgagattcgagtcatggaatctacgaataaggaattgatggcgacgttggctacaactcgtgatcagctcgggaagatgcttcgcgaacggaatcagttggtgaaggacgtcgatgagttgcacgaggaaattgagaaaatggagagcctctacaataagccggccgactacgcctcaaacagttataccgacaacatgaagttgatgcttgacgagctgaacgatcagtgtcgtaagtgggaaactgagaaggccaagttgaccgagcacttcaaagaggctgaaactcagctcagaagagagaatgttaagctagaggctcagaaggaggatatcttgaaccatacgaagaactctgagaagatgtggaacgaacgtcttgagaacatcaccgccgactttgaacgactcaaatcttcatcgaaaccaagtggaattcgtgccgaccagaaaatgttccaggagaatgagatgaagattcaggaattgaacagaaaactcaaagatgctcttgaagctattgaggaaattgaagacgccaattcggctctccgcgttgatctcgaaagaagaggagtcgagaagtgcaagatggaagaagagctcaacttccacaagggcttcttgatcgccgagcaacagagctttctcttagactgtgccaacttcgagaaccaaattgccaacctcaataaggagatgacagagctggaggagctccgtgacgcctacaagcaacagatcggcgaaatcaccgagaaacacgcccagcaaacgatgacattctcgaatgagaaggccaagttctgtcatgccatggagcgcgtcgaggagaaatggaatgctgaatgtgtcaaacttcgtgatgaaattggtggattgcagaaaatgttgttccaatcaaccaaggaaacgatggacaagcgggagattttcgacgaggaatctcgtgaatgtcgccgcaaaatcgacgagctcgagggcctgttggcaacgcaacaagcagcggcgcaacgacagattactcgactcctggccgagattgatgatctcaatgtccaattgagtgataccaaatcagtccaggcgaacgcagtgaaggagtgggatgtcgagtgtgctgagctggaagaggagatctacgagttgatcggcaaacggaagactgaaggaaaaaagttgagaaccatgcagagaaagaatacctggcttaccgcgtcgattagacggctctccgagcaacgccgtgaagagcttgctgccaagaaagatgagattttaaagcttaatagtctctgtgagcttcaacgtatggaaaaagtcgagtggctcagtgacttgaagaaggatgtgaatgcatggaagaatgaaacttccgtccgaatcgaattgaaacagaagatcacagatcttgaggagcaaaacgaaggtctcgaggagaaggtcgagaacgtgcttgcccagtacagaagcgagtgcgaactgtaccagaacagtgtatcaagccttcaaatggatcgtgacaggctcagaaaagatgttgatttgtacaaaggaaaggccgagatactgttcacaaagttcggagatctcgtcaaaaccaacgacgaattggagaagaaggcgcatcagaagatgctggaggcagacaacttgcggaagacagtcgagttctcgaacatggaaatgacaaatgtgaaagcgctcatggcgatggagcgggagcaaatcctcgaagaacgacactcaacggttagagatcttgaggagaagctcaaaaatttgacaatgg