Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y39G10A_246.H_b   

sjj_Y39G10A_246.H_bSequenceATGTTAACAAGCCAGGATCTGAA
PCR_productsjj_Y39G10A_246.h