Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.a   

sjj_Y39G10A_246.aRNAiJA:Y39G10A_246.a
PCR_productsjj_Y39G10A_246.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y39G10AR.10 Source_evidenceePCR2034WS150 Sequence/Annotation Release
Chunk_score Abs_score1956
Max_abs_score1956Y39G10AR.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI23001562302637
Overlaps_transcript Y39G10AR.10.2 Source_evidenceePCR2034WS150 Sequence/Annotation Release
Y39G10AR.10.1 Source_evidenceePCR2034WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.a2482gaggatcaagagccggtaagtatttgagctgttctagattctgttgagacacaaaaaatccattttcacacgtggtgccagagtctgtctcatcacggtttgatctacaaaaaacgcgggaattttttgcacaaaaatatgttcttaaccatgcgaaatcagttgagaactctgtgtctcttctcccgcatttttttgtagatttatgtagatcaagccgaaatgagacactctgacaccacgtgttttcaatgaattctggagttttgaaaatagttgaatgtgccatgaacaagtgtttatattttagatcgaattggctgaagactcacttcaaaacttggacaaaatgctggctgaggaaaaagaagaacaccagttgttgaaggacgaagttgtgcttctcagaaaggtgagcaacttattcaattcactatttagagaattgagaaaatcaattcaattaatgaaattaattaacttaatataactaataatagaattaatggaacttaattaattagtaaattgcaatttttcaagctataaacctattatttttcaggaaaacgtggaagccaagacctactccacattattggagatcatgcttgacgaagccgaagaaaaagcatcgtccgctcaagaaacgacctccgaagaaaacaatctcaaaattttgaaccgagatcttgtggccgaaaacttggaattgaaagagatgaaagaggagctcagaaagatctggttgagcgactcgaaaaaatttcaagaagctcttacgcggatctcagatgagaatacaaaacttcaaaaagattgtcacgagttggaatcgattcggcaatgtgcccagtttgcattggataactgtaacgaggagctcgagaaaacccaaacggaaaacgaagagcacgagagccgcattgagacgctggaacgtgaagtttgtgaaaaagatattgccatgaaagatattgttgagcggaaagacgagatttcgcttcaactggaattgcagacaaaggagttcacatctgcattgaatgatctgatgtatggaagagaagacaccttgaagcagatccatcaaatgaaggaaaactggaaggtcaagcagaatgaatttgaagttgaaattacaaagttgaagagtcaaaatgactactttgactctgaacgattgcaattgactgaccgaattagagctttgctcaacgagttgtccgatgttcgcctggaacttggctctactcgtttggcaatgaaggaaaaagctgaagttacagaagcggtgaccagtttcaacaaagatcttcgcgataagttggaagatgaaattgcaagactcggtgaatgcttacagttcagaaaggacgaacacgaacaggatgaagcagtcattgctcatcttgaagaacaactcaaacttggcagtgataaagctgctgcgttttccagcgagcacagtgacacgattgagttgctccgtgagtctgaaaccgaactgatggagctcagaatggagaattacgatctgaaggaggacttcaaaattttgaaggaggagaaagaagatgtcaatcgcacatgtgaatgtctccgcgaacaattgagcacaacaattcaggagcgggacatcgaaaaaggccagatgcagagtgagatggatgcaaaaatggttgctgtgcatcaacagtacgccaagcaaattgataatatgaagtacaatcatatgttggcaattaatcaggagttgatcaaaggacaaatggctctggaatctgggaagaagaagcacgccaatgagattttgacggtacgaaacgaactagagcaatccaatgctgctcatcaaagcttgagagaccagtgcagtttgcttttgagctccgaagatgatctcagaaccgcacatttggctttagaaagcaaaatgactctcgtttctgaagaatgtattgcactcagagtgtctcgagctaatgctcagaaagaaattggaaatttgactgaacatcacaaacttgaagtagcactcttggaagatgcgaaatccggaatccaacaacgtctccattacgccactattgaaatcgagcagctaaaaaagatcaatgaggttactcaagcccagtttaagaaggaaacagatgagaaaaatgccgagattaacgaattccaagctgcaatggtatcaatgaaacagcaatacaatgttcttggcaatcattgtcgcgttctgacatctcaaggaatctcggatcgtaccacaattgacaaactccaggaaaccattcgcgagcacacagaacttgcaatcgaaacgaagagaattcacgatgcagagattgttcagttgaatgatgctcataagaagttggtggataatttgggagttgaagaactcgacgaggagccgaaagcatcaacggaatcggaagagaaggctgaatgggagatggtcgacgaagaataacaa