Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.b   

sjj_Y39G10A_246.bRNAiJA:Y39G10A_246.b
PCR_productsjj_Y39G10A_246.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39G10AR.9 Source_evidenceePCR1206WS150 Sequence/Annotation Release
Overlaps_Gene Y39G10AR.21 Source_evidenceePCR238WS150 Sequence/Annotation Release
Chunk_score Abs_score238
Specificity_index0.159
Rel_score0.189
Map_statusBottom50_percentile_ePCRI23072732309333
Y39G10AR.9 Source_evidenceePCR1342WS150 Sequence/Annotation Release
Chunk_score Abs_score1237
Max_abs_score1237Y39G10AR.9
Specificity_index0.841
Rel_score1
Map_statusBest_ePCRI23072732309333
Overlaps_transcript Y39G10AR.21.2 Source_evidenceePCR233WS150 Sequence/Annotation Release
Y39G10AR.9 Source_evidenceePCR1342WS150 Sequence/Annotation Release
Y39G10AR.21.1 Source_evidenceePCR238WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.b2061cataaacggtagtaaaggcatcggcacgactttgcaaactacggtagatattttcttttatcattcttaatagttttcagagagaaaaatcgcttttatgtattctttccctcctaaaactgattattccagataaaaatggaagctgaaacagcccaaaatccatcgaaaaacattgacgaaacgctttcaattcaacatgattggcacctcaatttgaggtaaattaatatacatttccatggaaatttatttttttttcagagaaccagtctcgcagttctacctcggaatcaagaaattcgaggctacgaaaaccgaattcttccaagtacagatcacaaagcttgttgatgagtacggattcgctgtgatgccagaggaaggctcaattaaatcttccgacttcactgatgtttctctcgatgagcataaaaatctacatgtcactttccaagggagaaccacaattttcgtcggtcctaccagtgagcagaacctccgagggctacaatcagcgccgcgctcgttcgacgtttcatgtaccggaagcacttttgttgcagctgattcgagcggaaagctgatcattgcgaattcgagaactgccgagactctagtgggtctttaaaaacaatattttagcgcaaaattttgatgattttcacctgaaaatttaataattttcagacagaactcaccggccacactatggacatctaccgctgcatgtatttcccgtcgggtctcgtcgttattggcggtggaatggatatggcgatcagagtatgggcagtggataaagtgccggctcagaagacgttcgtcgggcacacaaaggcagtaacaggcttcgggatcatcggagttggacgagagttcctctcgtgctccaacgacggaacagtacgattttggagctgcaaaaatgctgcgccaaccgaaacatggagcttcgagaagggaaaatgcattgacatggcaatgtcagtggatgactcgagattcgctgtcatctgcgaaaacaatttcctatcagcgattgatctgcacggcgacaagattcggcgtgatattcagcttccttccgttcctacggctctctgtttttccggagatgaaggtggaaaagcggtgttcgtcgggtttgaggatggccacgtggcggcctataacgtgtcggatcgccggttaatcggggaaattgtcaccaaaaaaggaagcgtcacctgcctcaaatactattgcaatcgactaattgcatcattcagtgagaaaatatgagcttcaaactttatatttaaaaaataaattaattttcagccaccggaaatgttctcgcctttccgatcctttcccttcccacctcgtcaagcatcatctccgccgagtacgagctaaccggtgccgattgtgagccggtgtacgatatggcgatttatcagaagaatatttatacatgttgtcgtgatggcaaaattcgaacttacaaggcgcaatggagcttgtaattgagtattattatatatttcttatgtttaactattattgaactacatatttttgaatataaatctgtgattaaccggtagaaatcccaatttattttgtttttaatttggtcctaaaaccttttatttcatcagttttaccaattttccctttttttttctaaaattacttgaataagtaaatttaattcagaatgagctgtctgcgacaatcctcacaatcgttctatttcactcaaattagatggaaaactgtcaagttcaagacaaaaatcgcaaaaacgaagccactgaaaacgccatcagcccaggcgctggatcattttgatttttattatggcccactttttggaaagaaatggccaagtattcggctgggccttctgtctccgaatcgatatttagcagttatgaatacaatgagcaggttcggaaatctgaaattcccgtggaaattgccaaaaattttaatttatgattttcttatgtcaatttttaagaatattttgattttatttgctaaatattgctcaaaatttgtcctgaaatt