Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.d   

sjj_Y39G10A_246.dRNAiJA:Y39G10A_246.d
PCR_productsjj_Y39G10A_246.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39G10AR.7 Source_evidenceePCR1425WS150 Sequence/Annotation Release
Overlaps_Gene Y39G10AR.7 Source_evidenceePCR1435WS150 Sequence/Annotation Release
Chunk_score Abs_score1330
Max_abs_score1330Y39G10AR.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI23162662317950
Overlaps_transcriptY39G10AR.7 Source_evidenceePCR1435WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.d1685cctcgatcggataaaacatacactctaaatgataaatttcagcgatgccggccccgaaattcatcgaaggtccgaacactgttcaaacgtcactttacggctatgacaggagcaagaaagtgcaggtaatactctgaattgtgcgattttttccacccactaaaacataacctagttccagctgaacaatttacgcgggaaaccaattatggtgctccgttctgatacggtcattccaaaaaacgaagaagcacctccaccacgaagcaccttcgccaagaagtgggtcgatcgcagtcgtcatattccgacaattccactatgtaggcgacaattccatgtccttaacatttcccaaagaaaatacaattttaaattgcagacaaatccacgtgcagatcctactcgcactttcatcatcagtacacatgtccgaaaccttcgtcggaatctgcgttcccgtttcccatctcgcctactcaaattgatctcccattcgggcatactgcacacgacaggaaaccatcatgcctaccaactccacgtggctctccaaacagtccgagattgacgccggaagacgagatgactgtgaaacgattgtttgacaagctggagatccctacgacgccggcaacatcatccgccagctcgtcctacgtttcgcacaaaacacttctagagctcaattcgaaggtctccaaaacatcagccatcgatgtatccgttccaccagtgaccgagagttccgaggcggactcagtccgaattgatttatcgtttctcgtcgatacaccgaaaagcttgtcggattcacgaagatcctcgtgctcggacacctcgccgcccgatctcgaggagattgcatcaagctgtgatgaggtggagaagccgccgggtcacacgtatgtaaaaaatgttcataaattttaaaaaattttttatttcagatgccaagatgaagctcaatgcaacattttccgcaaaggtgaatgtattgatgagaagaaggagcgacagaacatgatccaatggttcaacgatcttgtccaatggcgtcatgatattatagccaaaaagttggattctagtcgtattaataatcttaaataactcgttttttccagacgcttcggtccaccacgttgtcctccacctccattgacagtcacaatgattggagcaagccgttctcagcgtgcaaacccatttcatcgagtcggagaagttcacccatttgccatggaggtcatggatcacgttcgtcggaaaatggacgcgaaacgttcgtatcgtctcgttcccgctggtcctactttccccgcgccacacgagtttatggcgaacgcaaagtgtttggagccgcatctgttcgtggagtactgctatcagctgacagcggccgcttacgttgatactgggctcaattatccgaatcgtcggccaccgatcccgcctcgtatggagccgataccagagcaagcgtgccgggaatcgatttgctcgtcggcttccgagttctcatccgacggcgagtattccgacgattcggatgatacgaaaaacgagcgactgcgtcagaagttggagagacatcgtaaacgggagaaccgccttcgaaagctcttccgccgacgggaggttctagatgaaatagacgaggaagatgacgattaggtgattgc