Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.h   

sjj_Y39G10A_246.h RNAi JA:Y39G10A_246.h
Simmer:Y39G10A_246.h:Screen_A
Simmer:Y39G10A_246.h:Screen_B
PCR_productsjj_Y39G10A_246.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y39G10AR.7 Source_evidenceePCR223WS150 Sequence/Annotation Release
Y39G10AR.8 Source_evidenceePCR626WS150 Sequence/Annotation Release
Overlaps_Gene Y39G10AR.7 Source_evidenceePCR225WS150 Sequence/Annotation Release
Chunk_score Abs_score204
Specificity_index0.206
Rel_score0.259
Map_statusBottom50_percentile_ePCRI23150852316597
Y39G10AR.8 Source_evidenceePCR850WS150 Sequence/Annotation Release
Chunk_score Abs_score787
Max_abs_score787Y39G10AR.8
Specificity_index0.794
Rel_score1
Map_statusBest_ePCRI23150852316597
Overlaps_transcript Y39G10AR.8 Source_evidenceePCR850WS150 Sequence/Annotation Release
Y39G10AR.7 Source_evidenceePCR225WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.h1513atgttaacaagccaggatctgaagttgaaaacttgaagggaggagtcgccggaggaacattgaccaagggaattctgcgcgtcggacaagaaatcgaagttcgcccgggaatcgtctcaaaaaccgcgaccggtcaactccaatgccgtccgatcttctcccgtatcgactctctgtttgccgaaaagaaccagctggaatacgccgttcccggcggtctcatcggtgttggaacgaagatcgacccgacactctgccgtggagatcgactcgtcggtcacatcctcggagccgttggcactcttccagatatcttcatcgaaattgaaatctccttctatcttctgagaagattgctcggagttcgtactgaaggaaagaagaagggagccaaggtgcagaagcttgtcaaggaagagactttgctggtgaacattggatcgttgtcaacgggaggaagagttactgctgtgaagggagacgccgcgaagatcagattaaacgatcctatttgcacagaggtaattcccactttttataaaataataaatttaatttgtatttaaattcaggttggagagaagattgccatgtcacgtcgtttcgagaagagttggcgcctgattggctggggaaccattcgcaaaggtcaaaccgttgagccgtacaagaactagcggctatcatcgatttgttgtctacaccggttttgacatattattaatcttttccaattgtttctctccgtttttgtctctctattagtccaaaaaattttgtcggatccctgttttggttcttttttctgtcctcctcctgtttcctactattccacttccagtttcattgattatttttctttttgttgaaagtgtgcttggtgttttttcgataaattattggatttgagtaaaatctggaaatacattttataattgcagcaaagattcaggttttgaaaaacaaaacgaaaagtgcaggctacagtaacccaccttaaagggaggtttcattccttgcgcagatggtctcgccgcgatgagacttttgtagaatgtttacggtgttgtaggccgctagaaaattttcgaatttcatctgaatttctctttattttctccaattttctcaaatttttgttcgaaaatctgaataaaatgtataaaacttttattttaacgcctcgatcggataaaacatacactctaaatgataaatttcagcgatgccggccccgaaattcatcgaaggtccgaacactgttcaaacgtcactttacggctatgacaggagcaagaaagtgcaggtaatactctgaattgtgcgattttttccacccactaaaacataacctagttccagctgaacaatttacgcgggaaaccaattatggtgctccgttctgatacggtcattccaaaaaacgaagaagcacctccaccacgaagcaccttcgccaagaagtgggtcgatcgcagtcgtcatattccgacaattccactatgtaggcgac