Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.h   

sjj_Y39G10A_246.h RNAi (3)
PCR_productsjj_Y39G10A_246.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y39G10AR.7 Source_evidenceePCR223WS150 Sequence/Annotation Release
Y39G10AR.8 Source_evidenceePCR626WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript Y39G10AR.8 Source_evidenceePCR850WS150 Sequence/Annotation Release
Y39G10AR.7 Source_evidenceePCR225WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.h1513atgttaacaagccaggatctgaagttgaaaacttgaagggaggagtcgccggaggaacattgaccaagggaattctgcgcgtcggacaagaaatcgaagttcgcccgggaatcgtctcaaaaaccgcgaccggtcaactccaatgccgtccgatcttctcccgtatcgactctctgtttgccgaaaagaaccagctggaatacgccgttcccggcggtctcatcggtgttggaacgaagatcgacccgacactctgccgtggagatcgactcgtcggtcacatcctcggagccgttggcactcttccagatatcttcatcgaaattgaaatctccttctatcttctgagaagattgctcggagttcgtactgaaggaaagaagaagggagccaaggtgcagaagcttgtcaaggaagagactttgctggtgaacattggatcgttgtcaacgggaggaagagttactgctgtgaagggagacgccgcgaagatcagattaaacgatcctatttgcacagaggtaattcccactttttataaaataataaatttaatttgtatttaaattcaggttggagagaagattgccatgtcacgtcgtttcgagaagagttggcgcctgattggctggggaaccattcgcaaaggtcaaaccgttgagccgtacaagaactagcggctatcatcgatttgttgtctacaccggttttgacatattattaatcttttccaattgtttctctccgtttttgtctctctattagtccaaaaaattttgtcggatccctgttttggttcttttttctgtcctcctcctgtttcctactattccacttccagtttcattgattatttttctttttgttgaaagtgtgcttggtgttttttcgataaattattggatttgagtaaaatctggaaatacattttataattgcagcaaagattcaggttttgaaaaacaaaacgaaaagtgcaggctacagtaacccaccttaaagggaggtttcattccttgcgcagatggtctcgccgcgatgagacttttgtagaatgtttacggtgttgtaggccgctagaaaattttcgaatttcatctgaatttctctttattttctccaattttctcaaatttttgttcgaaaatctgaataaaatgtataaaacttttattttaacgcctcgatcggataaaacatacactctaaatgataaatttcagcgatgccggccccgaaattcatcgaaggtccgaacactgttcaaacgtcactttacggctatgacaggagcaagaaagtgcaggtaatactctgaattgtgcgattttttccacccactaaaacataacctagttccagctgaacaatttacgcgggaaaccaattatggtgctccgttctgatacggtcattccaaaaaacgaagaagcacctccaccacgaagcaccttcgccaagaagtgggtcgatcgcagtcgtcatattccgacaattccactatgtaggcgac