Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10A_246.k   

sjj_Y39G10A_246.k RNAi JA:Y39G10A_246.k
Simmer:Y39G10A_246.k:Screen_A
Simmer:Y39G10A_246.k:Screen_B
PCR_productsjj_Y39G10A_246.k
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39G10AR.12a Source_evidenceePCR103WS150 Sequence/Annotation Release
Overlaps_Gene Y39G10AR.12 Source_evidenceePCR295WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254Y39G10AR.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22976262298752
Overlaps_transcriptY39G10AR.12a Source_evidenceePCR295WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y39G10A_246.k1127aaaaggtgaacgggaaaagatagctcaacaaaaactatggatatgaagaagagaaaaaatacggtataagggggtgggatgagacaaaaaaatcaatgagaatcatcataaatattttttttaaaattaattttcgcggtgaagatgaagctggtcccattggaatacgacaacgatcatatgtacattcgtttactgcttcgattgtggagtagaagctgctgctggtggcttctgagtcgaacgatcctttgatggagcacgaattccgtgaagacctccggcagatggcattctggaaaatttttaattagtaattagtaaatttgaaaaaagaattgtttagaatattttggtattttttttccaaattttttacaattagcattgccaatcttaaaagttcaaaaatgtatgctttttattcgaaattattttttgtaccagatcaggggtgggtggcaattggtttgtcgtcaaattaggcaatttgccggtttgtcgaaaaaatcttttcacaactctaggttttcatgtaggcacaaaatgcctactaggtgccaatcgaatgccaatcgaaaaattgccggaatgaaaatttctggaaaatcggcacattgccgtcatatcgacaacttgccgaaaacgaaaattttcgggaaatcggcgaaccggaaatttgtcggaattgtgttttcgttttcgattttcagaaaaatagcattttttgcaaaaatggctcaagttttagccatttttttttagaaaagatgttgttttctgatatttttcttccgtcattagtaacaaaacttgatgaaaaattgaattttatcattacatctctatagatttttaaaaaactttctatgaaaaaaatcgaagaatcttatctactccagccagtcattttagactatatttttatcattttaagacaacaaaaataattttacaattctaggttttcatgtagtcagataaatgtttcatcgcctatcgataggcatcttcgaggcatattatgcctgccttgtaggcacctaattttgccctacaaaactactgattacattccttattagctcgaaatcctataacttttcctaacttcccacttttaaggg