Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y39G10B_248.c   

sjj_Y39G10B_248.cRNAiJA:Y39G10B_248.c
PCR_productsjj_Y39G10B_248.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F12B6.2a Source_evidenceePCR845WS150 Sequence/Annotation Release
F12B6.2c Source_evidenceePCR737WS150 Sequence/Annotation Release
F12B6.2d Source_evidenceePCR845WS150 Sequence/Annotation Release
Overlaps_Gene F12B6.2 Source_evidenceePCR845WS150 Sequence/Annotation Release
Chunk_score Abs_score761
Max_abs_score761F12B6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI22507302253193
Overlaps_transcript (5)
WB_DNA_textsjj_Y39G10B_248.c2464cccagatttacatatggaatggagtggagatgagcaagcaaatattcatacttctttctatattggagcatttattgccgtttttccatcggaatttcttgccaaaaagtgagtatgtcagctgattatttgagaagaagaagtgctactgataagaaatatgttcagaaattatttccgattaaacggggtgaatttattgaaaaatcacgaagaaattatgattggaagtgggaaatttcttaaattttgcacaaaaatttaaaaaaaaattgaagtttggtggactaagaaaagttaggccaccaaactttggtgaactaagaaaagttaggccaccaaacattggtggactaagaaaagttaggccaccaaactttggcgaattaagaaaagttaagtcacaaaatttttggtggactaagaaaagttaggccaccaaactttggtggattaagaaatgttaggccaccaaactttgatcgactaggtggcctaactttttttaggccaaccaaactttggtggacttttctgaaaagcattttttcggtttatgaaaactttcaataaaaaattagaatttcgctccaatttttcaaattttaaattttaattttccaagaaaattgggagaatataaaatttcaactttgcgcgccaaaattttctcaaaaaattttctcaaaatttttttttcgaaaatttgaaacttcccgaaattctccaaatttacagactagggcccaagaatctcttgtcatttgcacttttgctcaatatatttggctcccttctcaccccattttctgcaatttacctccgttcctactttccagtagctgcaattcgtttgataatgggatttggttacggttagtttaaaaattgatttttaaaaaaccgattaaaattttttaaaaattgataatatttcaagaataaataaaaattttttaaaaatcggtaacttttttgaaaattgataatttatttttttggtctattttttggcctaaaactcgaataaaataaaaaaaaacatatatgaaatagctttctaaaactttggaaaatcaataaaaaatttaaaaatcggttctttattcgataatttttttaattcggaaagttcttaaaaattcaataataatttaaaaatcacctataaaacctttaaaaaattgctaacatttttaaaataccaattaaaatttcaaaaaatcgatacgtttcccaataaatttcaaaacttcgacaaaaatttgaaaatattttttaaaaaattgagagcatttcaaaaatcgatgctattgcgaaaactcgatacaatttcaaatagtaattaatttttttaggtctatacaacaaattgaaataaaatgattgtttttaatcagtaaaaaaaattattatcgataaaatttcaaaaaatcgattaaaaagttttttaattgataaaaattcaaaaaatcaattaaaattaaacattttgaaatttttgtttaatttttaaattaacaataaaaatatcgaaaaactaactaacctatctttggatgctccacgacacgcgtggcctagaaacccaaaaaaaaaacctcttccaggcttcgtaatccccgctggaagtgtgctcatctcgtcttggttcccactttccgagaaaagcacggccatggcaatattcacaacgggaaatcagattggaatcgccgtttccatgttcctaacggcaaagctttgtcagcttcattttttcgaagggtggccgctggtttttatagtttacgggctcattggagcagttttcttggtgatttggcatgttaggctagcggataagccaagggagtcgaaatatatcacagcgacagagttgacctacatcaaaggcgggaaacagagaagaaaccgagcagagactatcgttagagcaactccttatatgaaggtgagcgtggaagagtttttgatttttctaggccatgtgcttatacactgaacatttaactgagccttttttcttcagtctaaaacaatcaatttttgagtattctgtttaaacatgttgaagaaaaatagcaggaaagatagctggcctagaaacccaatggaaaagtttcctaggccacaaactctgtatttttcagattatcctcaacggttgtgtctgcgccatctgtgcgtgttcatttgctcaaagtttcgtccttgtggctctggtgacctatcttccaaagtataatcaaatcgcgttcaagatgaatttgacgcatgtgggtttttttggggtaacaatttattttttacaaattaagcaaattccagaacggaatttggtcttctcttccatttttcatccaaatgatcaccaaattgttgttcgcgattattgcagacaaggttaagcagcgaaaagtgaatgcaaccgcagttacgaaggtctcaaatgctattggtg