Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y40H7A.1   

sjj_Y40H7A.1 RNAi JA:Y40H7A.1
[cgc5655]:Y40H7A.1
PCR_productsjj_Y40H7A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY40H7A.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
Overlaps_Gene Y40H7A.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
Chunk_score Abs_score653
Max_abs_score653Y40H7A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1514333315146055
Overlaps_transcriptY40H7A.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y40H7A.12723acttaataatgaggcgcattgaagcagcgaaacgtttccatcggcagcaacggtagtaccgataacaattgtcacgcacttaaacaaaaaatatgaaacacaaattaatttttttaaaacatttttggaaaataatgtttcacaaaattagggggctgagttttgcaagcctctaatgtttctaacggaagttgtttttcattcaattttgagcaagaaatttttatattaacgaggggtgcgcgggtagcttctcttaatggcacaaaattattgaaggcaaatatcattacactttaacaacaatgtgaaactgtagttttttttttaattttttgatgtcaaaaaattccacacagcttgtagaaaaacttctttaaaattaatttttattctcaaaattcacaaactcatatccaaattggccacttgattattcactggcttatttctaaacatattgaaaaagccttgccgataaactgatataatcattatcacagcaaaagggtctagcactgggtagatggaaattaaaatggaggttaaactagtggaagcatcattttttacattaaaaattggaagaatcattactattagaatgggtatgtagatgagaatcaaaggaacaatcatttgggataacagagctctgtagagttgtttttggacggcttcgtagacttttgaataggtgacacctttcattttgtgatggataaagtataggcatagaagaatcacggagaacgagagaccctggaaaattgatttttttgaaacaatttttatgtaaaagacaaatggaactgtaggaaaatttttagaatgattgtataatattcgcaaaatgattgaaagaaaaacgactgtaccaatgttttgcaaatcattccgacttttacaatatttgtaaaatagtagaaattatatttgaaatttttgtttttggtacatggagagaaatgagtttgcaaccgatatttcaaaaagatgttcacttgaaaaactgaaactttgcagaatttcagcagttaccaaaaccgcggtgttttttttcgaaacttttagttaaaatgggaaacttgtgaggaataattggttctgaaccccagtaggatcctaaaactagtgatttaaaaaaatgaaaccacatatttcacaagtttcgctaataacagagaaccagatttacaaaaagatttcaaattttggaagttttcaaagaagcaattgatgataagttttgttctcagaacaaatggagtacatgaaactgtaaaaactgtttaaattttttttctacattgagtttagaaaattattattgaacgtagaaaaactgtagaaattattttcacagaatggaagaatttgaagccaagtatttttgagccattttgtattaattttcacataagttttatctttaaaaaatcgttttttgaaaatgctaaatcgaacagacaacaaattttcaaaaattggctgattttattaattatgtgaaactgttgaagtttgttttttattctaccagtatgaataatctacttcatgattgtttcaatttggatatatgttttttttaaattctgaggaatagaacaatttcaattcaattactttcaaaatataaaagaaatatgaaactgactgttatttttttttaacaatgggaacaaaataactttttccttcaacttgatgattttaccagaagatctactctgagcaacttggaatttctgtccctgtatttttatgactttgaaacagcaaaaaaatgttcctagaaaaatttcttccaaaactggctttacagaatagttttagatttatttttaatcaatttgagatttcgaacattttcttaaacttaaaaaaaaattaaatttttttcatacagtttgtatcaaatacgcgtgcgttttacgaaatgttttcaaaaaatgtccccataaaatgtcggctgctagagtaagtcttaccatgatcagtgcaaaattgataaccataaaaatggttggccaattgagtgaccgtattcccaattcgttttcaacggcgtaacttgcagcaacatagtagacttccgtcatgttcaggttgaaacttgaagtcattactggtctgaaatgtgttttctcggctatcaatagctttttctaggcgttactatgatatttatttaacgacagtttgtgtttcaaattgttttataataactttttgaaacagtattttttggaatgagtatttttttctgaaaactcagcaaatgaaaattggagcttttcggccgaaaaaagtgcgctgttactagttgtttgaagggatcgctaaaacttacctcaaaacctcgtcaacctggggggtctctctggcaattaaaaatatgcaaagcccccaattcacaccaaatattccaaccaatccaaaccaaaatcccaagaatttccctttgaaatagtgcaaatatttccgacgacttattgcaaaacatctgtacacaaattgaacagctatgaaaaccaatgcctgactgtagcttgttccgtagattgctggaaataaattatggaattatgaggtgattgattcttctttcatcttttatttaatgtgcacaacttgaaacaataaattttttttccagttttaatttttgaaaatagtgaaaaatagctgaaactcacacaaaagacctcgcataaaaa