Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41D4A_3192.a   

sjj_Y41D4A_3192.a RNAi (5)
PCR_productsjj_Y41D4A_3192.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41D4A.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
Overlaps_Gene Y41D4A.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
Chunk_score Abs_score414
Max_abs_score414Y41D4A.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV17409051741780
Overlaps_transcriptY41D4A.6 Source_evidenceePCR475WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41D4A_3192.a876tcgataaattcccagaaaaatcaataaattttcagaagaatcaataaattctcagaagaatcaataaattctcagaaaaaatgaaaaaattggtttaaattcctaggaaaattaatttaattgcctgaaaaatctcaaaaaattcaaaaaaaaacatgttaaatcttgaatattcatataaattccaatctatttccgaattaaaccatccaaaatatgtgccacatcacagacagctctatcctgaagcttatcagccatcaactgaacaccaatcggcagtccatcttccgcaactccaactggaacagaaatcgatgggatcccggccaaattggcggcctgagtgaaataatcatcattatcctccttcgagaacaacgtatcccgtaattcagaatatttcggcgctgttccagacgctgtcggcgtgacaatcaaatcgacttcccggaaagcctggcgcaactcgtcgtggatgattctccgcacttttagcgccctttcaaagtacttttggcgatatctggaattttttttgttgtaaattttaatagaaattctaggaagaacccccactgcttcatcaggaaataatttccagcgaaaatccgccgtcgaacaattgtattcagggcttctgaccgggaagaagcatacatttcgtatgttgaagagtcgcttgaagaacgatggccataggcaacactgtcgtatctgaaaatttgaatttgtagaaggaaatcgcgaaaaatgttatgattttaacctctttttaaataattgtttcgcttttttttaaaagaagttttgttgaaaattttcagattttttgaaaaattttcagtaaaaaaacggaaaatttgaaatgtgttg