Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41D4A_5905.d   

sjj_Y41D4A_5905.dRNAiJA:Y41D4A_5905.d
PCR_productsjj_Y41D4A_5905.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41D4A.2 Source_evidenceePCR915WS150 Sequence/Annotation Release
Overlaps_Gene Y41D4A.2 Source_evidenceePCR915WS150 Sequence/Annotation Release
Chunk_score Abs_score852
Max_abs_score852Y41D4A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV17684921770014
Overlaps_transcriptY41D4A.2 Source_evidenceePCR915WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41D4A_5905.d1523attgcctgcaaagtgtgtaatttcctaccctgaccccggcgactgcattattttcaagccagaaacgggcggagccaaccgtgccttataagccagaagttcgggagtcattttcagcaacgcaacaatggacctcgaacaacgaatcaaggcttaccgctttgtggcctattcggcagtcgctttttcggtggttgctgtgatttccgtaagtttttgagcttctggaaattctggaattttttagaactgaaattcaaatatgataaattgagtttttatcagagattttgaatttgaatttcccgccaaaatttttctccaatattcaaatttccaggtctctgtgactctgccgatggtgtacaactatgttcatcacgtcaagcgatccatgcaaactgaaatcaacttctgtaagggctccgcaaaagatatctggacagaggtgaaccatctgaaatcaatccccgccagccgtaaccgtacagcacgtcaagctggttacgacgcaggtgtcaatggaggaggatctgaagcatctggtgcacccggtaactgtgaagcttgttgtcttcctggagcagccgggcctgctggaactcccggaaaacctggtcgcccaggaaaggccggagccccaggactccctggtaacccaggacggccaccacagcaaccatgtgagccaattaccccaccaccatgcaaaccctgtccccagggaccagctggaccaccagggccaccaggaccagctggggatgctggatccgacgggagccctggagcaccgggaagcgatgggcaaccgggagcagctggagacaaggggcctgccgggccaaatggaaacccaggagcaccgggatcccctggaaaaccgggagaagatggaaaatccgagccaatcaccccaggagcaccaggacctgctggaccaccaggaccacaaggaccaccgggagcccccggacagccaggacacgatggtcaaccagggacacctggaccaaagggaccaaatggaaatccaggtgctccgggagccgatggaaatcctggaacaccaggagttgctggagtcgctggaagtggtggagagaagggagtatgtccgaaatattgtgccatcgatggaggtgtcttctttgaggatggaagtcggcgttaaatgttcgttttcgagaaataaatcatttaattttcaatattttttttgttgcaaaaaatttaattttggcggaaagttcaaatttaaatttccgacaatttttggcaaattttttaaatattttcccgctgaatattctacttctcaaacaactaaggttttggcgcaaaattccaactttcaaaaatattggcgggaaattaaaaaaaaattatttcggaaacgagaattgaatatttgatttaaaatttcggaatacgaagtttagttttaaaaattatttgaaattcatttcaaaaaatttggtgaatattcctttgttttttggttggatgttcaaatgttcaat