Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y41E3.11   

sjj_Y41E3.11 RNAi (6)
PCR_productsjj_Y41E3.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41E3.11 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene Y41E3.11 Source_evidenceePCR899WS150 Sequence/Annotation Release
Chunk_score Abs_score878
Max_abs_score878Y41E3.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1504547815046660
Overlaps_transcriptY41E3.11 Source_evidenceePCR899WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y41E3.111183gtgttccgaggatccgtctaccaacgttgaaacgaccggatttcctgcgtggaattatcggaaaatcgatgaatcggctgatcctcctggcacctagaagacgcaagaattatattttggatatgacgaattgttttgcggagaagcggaaacgaaagttgatggcttttgaagagttcaacaggaaatgcatgcttttcgtgccggacgaggatacacatcagaagaggctcattaagcaggagcacgaggagaacgagaagctcgacacggatgcaatgatgcagcacaaggcagcaatgtctcttccgattgttgccgagggggaaccttgtgaggagctgatctttattgatccaccagctggatgtgagcaaatcgcgtttgatcgagtcggaaaaatgaattatgattgtcgatcgtggttggtgattccaggacgacgacgtggtggtggtggatataataatcatcataatcgaggggatcgtggtggtggaggtggaaactatcatcacggaggatatcatcaatacaatcgaccatcaactagtgggccaccatcaggaggagctcaatactcacctagaggatcctcctcatccaccatgaacatcacacataccacattcccgtctgtaccgtcgccactggttcgagaggagccgacgattattcttccgccggtcaagattggtctaccagtggtggtgtctacggctgatgactcgtcgtcgcctactgtggcggcggcggtggtggtagctggaaataatcaattctcattccccccaccgcctgtagtgatggctgctccggcatcggcggctccgcagactccaattcagcagcagcagaagattcagcaggttcagcaaccgaagaaggttgaagtttcggtatgtaccgtggcgaaggcgaagaaggaggcgtggtatcgcctgcaaacctgccgcacggttcttgtgtcgatttacggtgtgaagctgtgcacgattttagttttgaggatctttgatttttgctacaaaaaacaacgccgcacagaaatagaggcgggacgttattgcgcaaccctgccgcacggatttttccactccttttgttcattttttctccggtaaattttcaattttacttgttttattctctttcgtcgaattcggatagcggtggttacagt