Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie

RNAi_reagent: sjj_Y43D4A.d   

Overlaps_CDS Y43D4A.3 Source_evidence ePCR 984WS150 Sequence/Annotation Release
153WS150 Sequence/Annotation Release
Y43D4A.4 Source_evidenceePCR713WS150 Sequence/Annotation Release
Overlaps_Gene Y43D4A.3 (3)
Y43D4A.4 (3)
C27A7.6 Chunk_score Abs_score642
Overlaps_transcript Y43D4A.3 Source_evidence ePCR 984WS150 Sequence/Annotation Release
153WS150 Sequence/Annotation Release
Y43D4A.4 Source_evidenceePCR713WS150 Sequence/Annotation Release
WB_DNA_text sjj_Y43D4A.d_11693ggttgatttaggaactgcaagtgtagcctttttagatttaaaaaaatccatagaggaaatttagacatatagacacaatttttttcgaagaccctggtagaagaattttaactcaccattctcaatgtaatgactgaacatgaaaatccaacagtgcaaactctgattatttcctaaattttagaatgatattttctttttctgattcactcaccttgaacttgcgtgttttgtcggcaatatgaccagcgagcagtgatgttaacgtgccaacgattgcacacacggcagttggatatctgaaaaataaatgaattactcatatgcttctagaactctgcaaagttgttacccagccatctcataaccttgatctttgagtggaccatcgagaaaaatcattagactccacagaagcgaaaacgcaaatgcaaagagagtcatttggatgaaaaattgagcattactgaaattaaagtatttaaagtttttggcgtgatactaaaaacctacaaaatacattgaaggatagatttaaagaaaccaatgttgttctgatgagcagcagaagaagctgatggtggagtgggtggcagtttagttcgaacgaatagtgctagaacaaatggaaacaaggctagacattccattccaagagtctgaaaatatgaattgtcaatgataattaaattgagtactaacaaatgtgaagaacatccaactattcgaatcaatagtcttattgtgaccaaaaagaatggatggcacaattgttcccagggcaacaccggcaggatttgctgaaattgattttcttaatgaattactgacaatcattaaaatttcactaaccaacaaaagaaagtacatttgcaattgctctctgatcaccagggaaccagcattcagcaatttttgatggaagaactaaaaagaatgcttgtgctgaagcagcgataaacgatcctgcatgaagaagacattcacgaacaaaatgtgattttatgaaaggaatcgaggcaatcatccgaatcgatgctccaattacatttaaagttgtaccaagaagaccctgaataaatatttcatttggaggttaaatatttgcaattcccacagccgtttttattcctttgttatcagttatgtacattccaccaaatccagtgaacacggcgacaaactgaaaatttgatttttttttcttctcctttttttcctattttatatatattgcataacccaacaaaacctggaaaatttgatttgtgacaagtgatacatcaatgctcccgttggctggacgtcctctataatatatctaaacttcgtcggatagagagctgaagcttatccattgctgaaattacgaataatttcaaaaatttctttttcgagtttaccattgcgtttgaaagagcaagaaagcaacaaacagctagaacgagccatcgagctgggtagacctgaacattaatgaattaattaaaaattaattcactgaatatcatcagtatttaccttgtatataacactattttcgctgattcctccatttgccgaagtatccttatctgcggcgacggcttctttgttgatcgccgatcccatcaacagctgaaaaatttaattaggttcaaaagtgaagcgatgcgaacggtttagccaacgggagcattgatgtatcacttgt