Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_Y43E12A.1_b   

sjj_Y43E12A.1_bSequenceAAGTGCAATGGGGAAACAAG
PCR_product sjj_Y43E12A.1
sjj_Y43E12A.1_1
sjj_Y43E12A.1_2