Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y44A6D.6   

sjj_Y44A6D.6RNAiJA:Y44A6D.6
PCR_productsjj_Y44A6D.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY44A6D.6 Source_evidenceePCR346WS150 Sequence/Annotation Release
Overlaps_Gene Y44A6D.6 Source_evidenceePCR346WS150 Sequence/Annotation Release
Chunk_score Abs_score262
Max_abs_score262Y44A6D.6
Specificity_index0.663
Rel_score1
Map_statusUnique_ePCRV2080999320811674
T06E6.12 Chunk_score Abs_score62
Specificity_index0.157
Rel_score0.237
C38D9.10 Chunk_score Abs_score71
Specificity_index0.18
Rel_score0.271
Overlaps_transcriptY44A6D.6 Source_evidenceePCR346WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y44A6D.61682cttttggcagtccacttttattgtcatttctgttctttcgattattcgtgagtttagaaacaatattgatttttattgaaaatacgtatactaatttcagttctcatggcattggggtttagcggtagaatgctgctaccttctagcatagtcctaagctcaatgatggcttctgcaggtaacgtcaacattttgtaaaatttggaatttttttggaaattgtttttcaggagcttgcgaaatgtggtggtgtctactgtcaatagcttattatcgtcatatttgtgataaaagggatcacccgttctctacatcagtctcaccagatcaggatccgctttgtgcaagagatagtctggtttaatttattttttgtttttcataattaaaaaaaattgtatttaggcgggttttcttgttgaaaaagcatacgatttactatgaaatgaattattaaagatttaaactgttttctctcaaacaatcgtagtgaaaaagtcaaaagtggacggcaatcggtgtttggcaattactgaaaatgccaaaaatttaaaattgccaaaggtgccggttaaattttcaaaaaattaaattttcaaaaattcaaaattcaaaaaacaaaaaattcaaaaattttcaaagagttttcaaaacttttaaaggtggagtggcgccagtggggattttgtctgaatgcatttataatgatccaaaacaaccgaatatcataataaaacactccaaaaatttttagatttttcataatttccggtcaaagtattggcctactgccaaaattttgaaaaatacgagctgttgaggaaatttgaagaaatgagatatgtttcgacccctacaatgttttaatacaaataatttaaacaaaattaaaacataaaaatgtcgaaaaaaattgttttttaaactgcttccaaaattatgagtggcaaaaaactgagtaattgccactttttgacagtaaataaaaaaatttcaaaattgttttgaaaagttttatcatgatatttggttgttttgggaccaaaggagtggtttttaacaatttctccactggcgcaactccacctttaaaaattatacatgaaattcgaattcctgaagaacggatcgtctaagtatccttagtaagtaagtaagttatttattcatattttttacagagttttcactcctcaaaatgcctcaaatctcaattaataaatttgtatgaacaattaaaacttttgtattttcgataagtattctttaaaacttcaagttttgatattgtgcccggttttttattcgttgaaaaagatgtgaacttcgcgaaaaaatcaaaattactgaaaatttatgaataacaatctctccacaaaattctagaaaaaatatctttaaatttcagggtttagaaatagcttttcaagtgttgcaaaaaactttccaactttcggcaactctcgcaaactttgcgccaactttcgctcaaaaattttaactagtgctttttgaaatatgattcacttcggtgacagcaaaaagtacggatgcttgtaaaatttttttgaagtttcaagtggattataaaaaataaaattgaaaataaaaataaaaacacttttcaaaaaacaagtcagttccccctcgttctgccaccccattctcacctgttggttata