Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y45F10D.12   

sjj_Y45F10D.12 RNAi JA:Y45F10D.12
Simmer:Y45F10D.12
PCR_productsjj_Y45F10D.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y45F10D.12 Source_evidenceePCR574WS150 Sequence/Annotation Release
Chunk_score Abs_score490
Max_abs_score490Y45F10D.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1377796613778774
Overlaps_transcript Y45F10D.12.2 Source_evidenceePCR517WS150 Sequence/Annotation Release
Y45F10D.12.1 Source_evidenceePCR574WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y45F10D.12809accaaagagtgagaacccttacctccgtcttctgtccaaggtaacacttagtttttgttgctctgtttaaaaattaattttaagctctacgctttcctcgctagacgcactggagagaagttcaacgccatcgtcttgaagagactccgcatgtcccgtcgtaaccgtcagccactctcgctcgccaagcttgcccgcgccgtccagaaggctggaaacgagaacaagactgttgtcaccctctcgactgtcaccgatgatgcccgtctctacactgtcccaaagatctccgtaagcatttcttttaccgttaaaattgtaaaaattattcttggtttttatgaaaccagtttagtactgaaataatacgaaaacatcggagtaactccggaattcttcaaaattcgtctcattttcaattaatttaatttaggtcgccgctcttcacgtcaccgaaggagcccgcgccagaatccttgctgccggaggagaaatcatcaccctcgaccagctcgccctcaagtcgccaaagggagaaaacaccgtcttcctccaggtatttcacaatttttctattatctttatttatttttgtacattttcagggaccacgatctgctcgtgaagccgagaagcacttcggaccagctccaggagtcccacactcccacaccaagccatacgtcagatcaaagggacgcaagttcgagcgcgcccgcggacgcagagcttccagagcctacaagaactaagttgttgttattttgttcccatgattgttttcgaatcatgccgaataaaaatgtgtc