Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y45F10D.4   

sjj_Y45F10D.4RNAiSimmer:Y45F10D.4
PCR_productsjj_Y45F10D.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y45F10D.11 Source_evidenceePCR69WS150 Sequence/Annotation Release
Y45F10D.4 Source_evidenceePCR462WS150 Sequence/Annotation Release
Overlaps_Gene Y45F10D.11 (2)
Y45F10D.4 Source_evidenceePCR546WS150 Sequence/Annotation Release
Chunk_score Abs_score441
Max_abs_score441Y45F10D.4
Specificity_index0.865
Rel_score1
Map_statusUnique_ePCRIV1378366313784721
Overlaps_transcript Y45F10D.4 Source_evidenceePCR546WS150 Sequence/Annotation Release
Y45F10D.11 Source_evidenceePCR69WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y45F10D.41059cagtaaagcatcaaaaaccttggccttggccgaaaaacttctcggccatgaacatgtgatggtgtcttgtgtgcgcccactacttctccattcttctttttgttatcgccgagaaaagtgatctctgctttaattctaaatgtttttttctggaattccctatttttatgcacaaaaatattgcctttcgttgctaaaaatccatgatttaacgtatttctacttttatattaattttattttttaaatataataaattaattccagacaaatcacagaaatgtcgcttcaaatcagttcagccgcgaaaacactcctgcacaagtttgcgttgccagcggcaacttcagttgctcagtatcacgagaaggtaggttttaaatcattttcaggcgttaaaaaatcaataaattacacattattttcaggttatcgatcactacgagaacccgcgaaatgtcggatcacttgacaagaacgatccaagcgtcggaacaggaatcgtcggcgctccagcttgtggagatgtcatgaaattgcagattcgagtgagttttttcacattttccggggaaaaaattattatattttaaagctaaaaacatttccaggtcgacgataacggaaaaatcatcgaagccaaattcaaaacattcggatgtggaagtgcaattgcctcatcttccctggcaaccgaatggattaacggaaaaactatcgattacgcgtcgaaaattaaaaatgacgaaattgccaaagaattgtgtcttccaccagtcaaacttcactgttcaagtgagcttttttccctatttttctcgatttttttcgcaactaaaaatgtttcagtgctcgcccaagacgccattcaagccgctttgaaggattatcagaagaagcagactaagaaggcctaagcctgaagaatgtgtaatagacaatttgttttcgttatagaaatcgctatatataaaagagcttttttgtcaccttttcagttgcataatgacgaattccagcggaatgcgacagaagctgtctcattgtgattttgacgtc