Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47D3A.v   

sjj_Y47D3A.vRNAiJA:Y47D3A.v
PCR_productsjj_Y47D3A.v
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.17a Source_evidenceePCR415WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.17 Source_evidenceePCR696WS150 Sequence/Annotation Release
Chunk_score Abs_score528
Max_abs_score528Y47D3A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1126514211267686
Overlaps_transcript Y47D3A.17b.2 Source_evidenceePCR344WS150 Sequence/Annotation Release
Y47D3A.17a Source_evidenceePCR415WS150 Sequence/Annotation Release
Y47D3A.17b.1 Source_evidenceePCR696WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47D3A.v2545ttcacgtcattttccgtatctctaacctttaacaaatcagctctctcggccaacgaattcttatccgtctcaactgtcccattcaatgctcgcattagctcgtcaccttgcttatcttcaaaaaaatcgatttttttttctcaaaaaaaaaacatttgaaaaaccctactcatcatattggcggctgtacgcaaatcacatagttttccagacatttgacgattcgccagaattagggcatccgatcgattcgagtcggttttcgccatttgagcatcctcatcctcttctggagccgcaaaaaatcgggtatttattgggatttttattcaaaatttgtgataataatatcaattgtttctattttttaatgagacacgttataatgtttagcaaaaaaagttttgctcgaatcgttttttcaaacaaattcaaaattctaatgttttagaaattttcagatttataagagcatttattaaaaataaaattatatactttttaaatttttaaaaagtccccatttttcacttttttccatgaaatgtaaatttcgttcacttcctttttttcaaaattttccctttttcagaaaatttcaaatttcaaactttttaggcatattcagtcaaaagtagctatgtttcaattctaaaaaaaaaactgaagactctgaaaaattccgattcatcggggtttcaaggcgtttaaaagttactatcacatttctaaaaaaattttcattcaaatttttcagatgctgttacgcttttgtgaataattcaaattctaacaaacgaaaaaattccgaatttcgaaattttaactatttttaagttattttttaaaattacttttactattaaaaataactatttttttttaagttttctgtcaaatttccacaaatatttcgaatttcaaattttttttttcttcaaatccctaccactttcagcccttgtgatagccttatgtctcatatattccagagaattcgtccattgttgtcggtccatttcattttgtggtttgacatgaaatgtctgtgattgtccggatattactatacacgatgttgtctggaattattgaatttttcaaaaatttatgaaaagtactcatgcaacgtactttaagattttcaaaaactttctgaaaacaacttatttctatattttacgaaaaattaaaatttttaaaaaattttcatacaacttataataatagtagtaaataatagtaattcctagttttggcatttacaaaaaaatttaaaaaattggaattttacgaaatttccagaatttcataatagtattaattgttttgaaatttaaaaaaatgttacgtacattttttcggaattttttaaaaaggtgtatataatttataagagtaaatgcctacagttagctatattaatgatttttttctctaaaaaaataatttttttccggaatgttttagactttttatatgacttacaaaagtacaaaacagcaaatactcattttaaaatatctttttttttgataattccaaaattttcgaaatttccaaaacaattgaacttttttaaagttaattttgttttatatcagaacagttttttctccaattttttttcttcaattttcactacagacatcaatcaatcaaacgaatgaaaaaaaaaccttatcagtatgaactcgagcttcttgcaggttgatacttccacgacacgtatgaccaacttcacttgggtttctgtaaaatttttgaatttcggggccaaaatgaaaattcggattctggtattttcaacgcgaattgaatttaaaaattttggtatattttctaaagttttcgcctttttgagttccaagaaaattagagcttgctccagctcctcgagaagcaagcgaatattcacctctcctgaagcccaaaaagcttctccgagtccccacacgccgactcatagacactctcatcatcccgatgatgagcctttcgacgggctctcaccgggaacgcacaccaggtgatctgcttgcgcgcctgacgaagacgtccgcgaagtgtgcccattattcgacggtggatttttgtcgacttttgtagtggtggtggaagtgatgatgggctcaaagagctcagcgagcaataggtagaagtcgaaggagaagaagaatagaaagatgaacaagaagtgaggagtgacgggaactgtcgtggaggatccttatcgccactcttctctgccttctcttcgtctctccttatctctccattccccccattttgcctccttttgctgatgtcgtcgttctcctcgttgctatcaattttcgcccgccgctttttctcgtttttgcccgatattccactggcagctgctttttgcatatcgtccaacattacacaatgattcgggaccatttttgaagcatcgcttttcccttctacaatgtatacaatggtagatcaaaatctttcgggcggaaaggaaattaggtcgatggatagaatatagttacgaaaaggttcaaattccaaa