Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47D3B.7   

sjj_Y47D3B.7 RNAi (7)
PCR_productsjj_Y47D3B.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3B.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3B.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
Chunk_score Abs_score698
Max_abs_score698Y47D3B.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1143678811437719
Overlaps_transcriptY47D3B.7 Source_evidenceePCR779WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47D3B.7932cggattttccaaaatagataggccaaaataagtctaaaaacccactctgtcaaaatcttcggcggacagttcctgatcagtgaatagtgttgccgtgccagctcattcttgttactcctccaatagattccacatgtcagaacgtgcgtccaccatgtgcaacaagcatctccgtttcgagagatccaggttccgaattctagaaatttataacattttcaatcttaaaattcgtgttcactaactcgctgactcatccttctcattagtcaaaatggcagcgcactgcgttgaaattgtcaccaaaagtcttgaaacatcaaccacgtctacttcatcatcgagacggtcattgtcatttaggatgcgttccacattttttgtaaagatctcgtcaccaccgacaagttcctgtacaagtttggagagtaggtacactttcagcgttgttcggattcgagcaagtggggatactggaaaatgaaagtttatttattttttattttattttattttattttaaaatacttacattgctcatcttccacaaaagacccaaatctcaactgcttctgcttcgagctcaacacatgctccaaccttttcgcatctgacatgaactttcttgtcgctggatggaagatccataacaaatgggacaccgagtgctccggagctcgacgcacgtgccttcgagctcttcgtaaaaagtatcccgagaagaatggtgcgagtaggttcggaagagccaaacggcattggatggatgcagaaatgtagatctgagccatgacggcgcgtggaagtccgtcgtttgatgctccggcagcttcagcaaggtttactgcacagagggacatgaagaggcccgttagggcggatggttcataggtgtcttcgaagtttccagtgatacccattagatggagctg