Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47D9A.c   

sjj_Y47D9A.cRNAiJA:Y47D9A.c
PCR_productsjj_Y47D9A.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C43E11.1 Source_evidenceePCR902WS150 Sequence/Annotation Release
Chunk_score Abs_score797
Max_abs_score797C43E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42720524273144
Overlaps_transcript C43E11.1.2 Source_evidenceePCR902WS150 Sequence/Annotation Release
C43E11.1.1 Source_evidenceePCR902WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47D9A.c1093gtggatggataaggttaaaagccattgcttcgttaaggtataccattctatttcaaacgtttttttttcaattaaattgagtatttcagctaaattccgatgcggacgctgggaatgttatcagtgcaatgaacaacgtcgtttggccagatggtaacccaaagagattgtctattgtctacgatacagaagataatgtgagatttccaaaagttttcagacattttaagcattgaatttcagttgatcaagcataggaatggattagaggctactattgccgagccggctaaaatcggcggcggccgagctgatcggctctcgaccacgtctcaaagttcgattcttggaggaaaaaccaacttccagattactgtaagctgggtatagttttattataatctagactatttattgaagatgcaaaatgtacttcgcgacaacgataagcttgattcggagcgcaaaagggagcgtggaagtattcaatcgagactcacacgcattgaaaacaaggatcaagtgaaggatgagaagaaagatgaaaagaaagaggatagaaagagaaaacgatcggagactcccccattttctcgtggtgctgggtttatggacgagaaaaaggctagaaatgaggagagggagcgaagacggtgagaaattgaaaattgaacgttttgaagaaacaataattatttcagagaaggcccgcgaagcgaggaacgtcgaaaagttgttgtcgaagaagaagaggctccgaaaaagtcactcgatcagctcttcaagaaaactgtagctcttccgccgatttattatctgccattaacggaagagcagattgctgccaaggaggctgagaagagtgcaaaaggaaaggagagagctgaaacaacatcagatcgtgatcgtccacatcgagttgacagaaatgatcgaggggatcgtccaagacatcgcgattgagctttaagcatcagctgtcaacattccagtttcccgatcatctctatattcataattacctactctcgagaaaaattgtcaaatattccccaccatcaagtttgtgttctttttgtaaatctcatcggga