Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47D9A.g   

sjj_Y47D9A.gRNAiJA:Y47D9A.g
PCR_productsjj_Y47D9A.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D9A.1b Source_evidenceePCR939WS150 Sequence/Annotation Release
Overlaps_Gene Y47D9A.1 Source_evidenceePCR939WS150 Sequence/Annotation Release
Chunk_score Abs_score834
Max_abs_score834Y47D9A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI43056914307927
Overlaps_transcript Y47D9A.1b Source_evidenceePCR939WS150 Sequence/Annotation Release
Y47D9A.1a.1 Source_evidenceePCR939WS150 Sequence/Annotation Release
Y47D9A.1a.2 Source_evidenceePCR939WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47D9A.g2237ccgcgtcagtataaaatatctcgaggaacctaatccactcggtacgtttatttccttgaaaccggttgtggaggttggtggtggaacgaaatgtaatagaattggagtaaaaaatatatgacctgttttatgacatgttttacaagaagaaaattgtttttttaccaatttgtttcaaggaaccgccggtggcctcgtctcgttcaaaaaacaaattctcgctggtgatccggatgcggttttcgtcatcaacgctgatgtctgtggtgatcttccaattgaggatatgggcgccaagttggactcgctcagtggatccagtatgcttatgctcactacagaagcaactcgtcagcaatcaatcaatttcggatcggtaaggaatatttttgaaggaggttcagctgatttcgcttgaatgttggtctcgacgcgaaatttttctgttaaaactaaaaagatgtgtgcctttaaagagtactgttatttgaagctctcgttgctgcagaaattttttaatcgattttcacagtatttcgattaaaaatatttttgcatatttataaaaactttaaaaaaactaaaacatccataaattttaaaaaattgtgggaacaactttaaaataatgttttattaatttaaaacattttcatgagaaatttcagagtttttcccaaaatttgctaaaatttatgtgtttttaatctaaaaactatgaaaaatcgaagaaaattatgcaaagtttgtacttacagtatcatttaaaggcgcatacatttttgcatttaacaaaaaaattgtcgtgtcgggaccggatactgtatttctgcgtttgagtaatatttataatggtcttccaaagtttgccccaatttttttgaaacttgtaattttttcaggttgtgacagattccgagggaagagtaatccattacgtcgacaagccaacgacttttgtttcgacgaacatctcttgcggtgtgtatctgatcaaagcagaggtcatccgacaactcgatcttccactgaacggcgatggaatctggttggaaactgacgttcttccacaactcgcttcttcgggaaatctatatgctcttcacacaactagatggtggagtcagacaaaaactgcggcgttagtagtttttttttaatttaaagaagccaaattttcttaaaatttcttgaatcaaaaaaatttcagtgcagttctctacgccaaccgtcactaccttcgcctctacaaaagacgttatgcagctagattgtgtaagaatggagctcagatcatcggagacgtcttcatcgatccaagtgcaaaagttcatccaaccgcaaaaattggtccaaatgtgagcatcgggccaaaaagtgtaattggaaaaggagttcgtatcaaggaatcgattattttgccggaagcagtaatcgaggaaaatgcgtgtgtccttcaatcagttatcggatggcgttcggtcgttggaatgtgggctagaattgaaggaattccacttgaaccgaatccaaatcttccatttgctaaggtaatattcattagaaaaaggggaaattgaaagtcaaagtttgtaaaaaaatgcaaaaattttaaaagattttcatagagtaaaattatgaataagaaaaacaattctcgatttctcgaatttttaactctgaaattgctaaaataaaataaaaacatttttccacaaaacacaaaaaagtataaatatctatgccaaattatcgattttgagctcattttccgcgaatttcgtccggattatcaagttttattacggtaaaatgtgtgaaatattgacacgtttttttccaataaaaaatcaatgaaaaatcaagaaaaatcgaattcaagaacaattcagacacttcttttattttgcaatttttgtgttaaaatttcaaaaaaaaaattttaaaaacttttttttccataattaaaaaaaactttaagaaaccctttaagaccttaagaaaaaaacccccaaaatttttcacaataaatattcaagtttcaaaaataatcgagttttgcaatttttctctgaaaatcaatcattttcggaattgtaacttaacattttccagatggacaacaagccactattccttccggatggtcgtttgaccccatcactaacaattctcggatctgacgtctccgttgctcctgaaactatcatcctcaactgcgtcgtcttaccgtataa