Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_243.a   

sjj_Y47G6A_243.aRNAiJA:Y47G6A_243.a
PCR_productsjj_Y47G6A_243.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.26 Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.26 Source_evidenceePCR591WS150 Sequence/Annotation Release
Chunk_score Abs_score528
Max_abs_score528Y47G6A.26
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI36189093620072
Overlaps_transcriptY47G6A.26 Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_243.a1164gatcccccgaaaatgatttattacaagtggatcaataagttctaggttctctttctttttctcgacttcttcgatctcttcgttctcgctttacgctcctctttttccgcattttccagactttttggactgaaggcttccgagatcccgacaaactctcgacagaagttctgatcatatctgtacaacggtcgctctccaatccagtatcgcaacggaggaattcggtttcgttttgggcgagagcaggagtctggaagataatttttattcgaaaagtggtttacattgaacaaaaacttacgatcgacaagcttggactttgccaggttgggatgaagcttcgactttttcgatattggagttgatgccatacttgggacaaaaacatcgtcgtcctgaacttcgacatctcgtcctgatcgatttctaggggatccttccgatgacattgctggactgcgcatcggatgctcatcagtagagtctcgaatcccattcattaccgggaatgcttgaatcgcagtgttagagttcctagtagagacttgagaaggctcgtcgaggtagctgagagtttcatcgattcccgcctcgtggagcatcatcatttcggtcatacgctgaaatttaagaattattgagagctgggaaaagaaattgaactcactcttcctggtacgagggtgcttcgaggacgaggaactctgcgtgtatactgatcagccattattttttttcttctatcgaatctagtgtttagtaattccgaaataattcaattttcgattgaattattttttttttgttggaatatttttaatttgagcaaaaaccagagcaccacgggaaacaattatttttgtaaatcaagaattaacttggttatacaattttgacaaaggaaaaaatggagaaaacgtaattttcaacatttttcttgttcacaatatttttctaactgttatagtatttgtgctatattacgggaacattaaattctgagaatgcgtattacacaacatatttaacgcgcaaaatatctcgtagcgaaaactacagtaattctttaaatgactactgtagcacttgtgtcgatttacggaaatcattcaatcgatatcaggcaaaataatacgaatgatcgaaggaaaatttgtcaat