Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_245.d   

sjj_Y47G6A_245.dRNAiJA:Y47G6A_245.d
PCR_productsjj_Y47G6A_245.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y47G6A.21 Source_evidenceePCR493WS150 Sequence/Annotation Release
Chunk_score Abs_score367
Max_abs_score367Y47G6A.21
Specificity_index0.658
Rel_score1
Map_statusUnique_ePCRI35578813559682
Y47G6A.22 Chunk_score Abs_score191
Specificity_index0.342
Rel_score0.52
Overlaps_transcript Y47G6A.21.1 Source_evidenceePCR493WS150 Sequence/Annotation Release
Y47G6A.21.2 Source_evidenceePCR493WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_245.d1802tcgtctatttttccgcatttttaaaaatcaaacaatcaatttatcttaatttgtcaggttgaataatcgaaatcttgctttagaattactttaattatttgatcttgctgtgaatattttaaaaaaacagttaaaattttaattaaaatagaatcgtgcggcggagttgcgcttccgactccgcccattacttcttgcgtgtcgttagaatagacttactgccgcatatgtagcttcatcctgcccagatgctcgatgaatgttggttacaatgactcctgggctgaaatttattttaattattctcaatttttgggctcttaatatgaaaatatttaaatctcaccaaacagcattaacacgaactccattcggagccatttccagagccaaacattttgtgaattgatctacggccgatttggacatacagtaatatgtgaccccagcgaactgaaaattgcgaattcgaaatatatttttttttaatttccaaaagaaaaatcatacagggcacggtccattaatactgctgacattgacaacagttccttttgttgtaataatatgtggaagagctgcacgtgtcaggcggatcaaactacgaacattcacattcattagctcatcgtagacttcaattccagaatcgagaactggtccggcacgcagaatcccggccgaattgatctgaaatttagaatattttaagggtagaatgggaaatttctcgaaaaaaaaactatggatcctggaaaagtgaagttttttatttttcaagtttaaattttgaatagtattgacttcataaaattgaaaaaaaacctattgtagttccgcaattgttcctgggatacgaacttaaaggcgcacgcaattatctagttgggtctcaccgcgcaaaaacatttttcgtggcaagacccaaccgaataaatccgtgatcctctatgtacgcgtttctgaaaattttgtaaataataaatggataaactctaaatttccgaaaaacttttctctcgatagtttcaaattgtttcgaactgaatatcctcaccaatgagtcaattcttccgaatttttgtacagttgcatccacaattgctttgggcgcctcatcagagctcagctccactgcagttatcagaatctggaatgaaaatcgattttttaattgatgtcgctattttttccacctaaaaacgttcaatcccctttttttgcaaaattttgcgatttttggtctcgaaacgacataataaaattcatagctacagtacctgcaagtgtttgtaatttttaatgatttttagtatacttcttgatattcgatgagttttaatatttttttttgtatgtgtcaagaccatggcggcggttttttttaattaaaaaaataattttttttgttttttcgacaaaaaaacggtgtttccaaaaattacaaacgaggaaaaaaaatcgaaatttttttgtgataactgctatcatgagaacacaaaattctgagaatgcgtaatgcacaacataattgacgcgcaaaatatcaaaactacagtaattctttaaatgactactgtagcgcttgtgttgatttacgacaccagagttacagtagtaatttgaaggattactgtagttttcgctacgagatattttgcgcgtcaaatatgttgcgcaatacgcaatctcagaattctgtgttcccgtaatactgtactttccgtcacagttcctaaaatataaaactcacatcatcagccgaaattgcaccctctgaaatacatagtgctgcgacttcc