Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_245.k   

sjj_Y47G6A_245.kRNAiJA:Y47G6A_245.k
PCR_productsjj_Y47G6A_245.k
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.23 Source_evidenceePCR847WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.23 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score826
Max_abs_score826Y47G6A.23
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI35762383577084
Overlaps_transcriptY47G6A.23 Source_evidenceePCR847WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_245.k847tactgcctcagcttatgcttttccgcttcgataagcttattcgaaactccacgtgcagctaactcaaaaaccgctcgggaatgctcatgcatcttattctccatccacggaaccttctcctcagccttcaactttttcaactcagaagctccttcaactttctcctcatccgaatccaactctccctcatcaccccaaaacgacatatcatcatcatcatccgtccgaatcatggagaacgtgttgacgagaagctttgcgagtttaccaatccgagtgtccaagtcaatctcaacaccttgcatttcagcagacacactgagcacccatttcgcaggtcctttcgtggcttctgctttggagcacaactgataggttccttcagggaaaaagatacaattggattgatcactgtgtgtcgcatccaagaaactttgtgtaagagcctgctcatcaaaatcatcgacaaacgagcacttgaatccattgaacgatgccttgcaagtcagctccttcttcactagcactgataggttagacttctgcaaagaaagcaccaatgcgggcattccttcagtaacatcatgactgtacagtggcatgcacatgtacattccattattaatcgccagtgatagattcatatctgcatcctctgcaatttgagtcggcgagaacattccggcattcgatagcttcgtcgtcgtcttctcctgtactaccttctcccgctcattcctccaatagtcatacgtgttcttgtagttaagccatagcagaatcgccttgtcaattgcagcggctttcaccagaaaaatcgggcgattcagggaaatgtggtaggaat