Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_246.a   

sjj_Y47G6A_246.aRNAiJA:Y47G6A_246.a
PCR_productsjj_Y47G6A_246.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.13 Source_evidenceePCR1131WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.13 Source_evidenceePCR1131WS150 Sequence/Annotation Release
Chunk_score Abs_score1047
Max_abs_score1047Y47G6A.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI34398033442073
Overlaps_transcriptY47G6A.13 Source_evidenceePCR1131WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_246.a2271ctgctagccatatcttttgcactgatcaacttgttgcccttatccacattcaacgtatcctgctgctgttcaccggaactgttatccttcaccttcttctgctcatcaacctctccagcaacttccgactcggctttcgctgactttgctggaatcgcagttttcatcgaatcggcagacaactcattctccttattttccttttcctttttctccttctcttccttctctttttcctctttctcagcttttgccattctttccatctcgtcgtcttcccattcatatggatccagaaagttgatcttcagtctggtgatagccgccatcagctgaaaaatttcttaattgttaatcggattctatttcgagaaaaacgctaccagattataaatcttctcatagttcgggcgatctgcgtagctcagagttctcaggtactcgaagattgatttgagctcgtcggggagatcctgtaaatgtgcaaaatgttcaaaatgccgaaaaatgcattttcttgtgagtaccatttttgatggttcattccgggtttcacgtctcattttgctttgatctacgaaaaatgcgggagaagagacgcagacatctcaactgatttcgcagggttgctgacgtcacatttttctgggaacaattcccgcattttttgtagatcaaagagactttctgacaccatgtggcgtttcggaaattcgaatttcccctgttttcaaaaatccacacctcaaacagtgcaaggtcctttgtcgacttcttcattgacataatttccttttcatccttcaaattcgaccagggaagcccgagagtcagatacacgatgctgtagatcattgccacgagatcatcacatcgtccttgctccttccgctcgtggacattcatcgaacaatatcgaatcgttcctctcaacggaatgcgtcttctcatcgggcgaagcttcttcttgccatcgtcaccagccatcacaaatgtccgagccatcccgaaatcgatgagtaacatgactcgagcatctcttcccttgttggccgcggtcattatgttccccggcttgacgtctcgatgcacatatccagcttcatgtagttgcttcaagccgtacaacgtgaacactgcgacacgcatggccgtggcgtcgttgaagcctcgctgaatcttcatgcgaagtgccatcaaatcctttccgcagagggtggtcaccatgtatctagaaaattcgagttttcgcacaattctacgcttcctcactgcaactttttccccacgagggacgaggaaatgcggtttctaggccatcacgtggtgccagactgtctcaatacagtttgatctatgaaaaatgcgggaatttttcccagaaaaaagtgtgacgtcagaacgctctaaaccatgcggaatcagatgagatctctgcgtctcacctcccgcattttttggagatcaaagcaaaataggactttctgactacacgtgggccgaggatccgacaagatttagtggcaagctatcttactttgttttccgcgtgactttttttgtttttcacagatttttcccgttttttctttcatattgaaactgataaataaatatttttgcaagtgcgaaagcaatttaaaagtgaatacacaatttttcacttggaaattgttttagcatctgcaaaaaaatttatttatcagtttcaatatgaaaaaacggggaaaaatctgtgaaaaacaaaaaaagtcacgcggaaaacaaagtaagatagcttgccactaaatcttgtcggatcctcggcccacgtgtagtcagaaagtcctattttgctttgatctccaaaaaatgcgggaggtgagactcagagatctcatctgattccgcatggtttagagcgttctgacatcacaatttttctgggaaacaattcccgcattttttgaagatcaaactgtattaagacagtctggcaccacgtgatgatggcctagaaaccgcattcctcgtccctcgttcaaagaaaagtgctgtgctcctgctaacctgtaaagcttcctcttcccatagtcgataagcttcaggacatctcgtgaatccgtcaacttgctcagcacattcacctcgagttgcagtgttcgatcgaattcttccgagtcgtactcgaccttcatcgctgcacaataccctttacggttcttgtcctccaccttgtacacgacaccgcacgcacctttgcccaaaagtgctttaattctccatttgtcg