Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_247.a   

sjj_Y47G6A_247.a RNAi JA:Y47G6A_247.a
Simmer:Y47G6A_247.a:Screen_A
Simmer:Y47G6A_247.a:Screen_B
PCR_productsjj_Y47G6A_247.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y47G6A.18 Source_evidenceePCR823WS150 Sequence/Annotation Release
Chunk_score Abs_score781
Max_abs_score781Y47G6A.18
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI35094423511399
Y65B4A.8 Chunk_scoreAbs_score59
Overlaps_transcript Y47G6A.18.1 Source_evidenceePCR823WS150 Sequence/Annotation Release
Y47G6A.18.2 Source_evidenceePCR811WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_247.a1958aaagacggaaactcttaaaacggtgcgtttttggaatttttttcccgtttttcgccgataaaatttaacttccaacaaaaaaagtgcaaaaccacaatttgccgaaaaaatatctcggcaatttgccgatttgccggaaataatcgtttgccgcccctgctctgttagtacttcacgttttcagcgcttagctcaaaaaaaatctgctaaagctgaagtgcacaaagacaaaaaaaaagctcaattttttcccgactcactggttgtggattctacttgctgaacgcctcaaaaacagcccacatcacgtcgtttcccttcttttcggcttgctggtcgtaatcaagatcgagcagactacgcactcgtttcattgcaacctggaatttttataattgatttttctgaaaattggcgagaaatgtcagcatttcaattaagccctgggaagctcaatggagcgcgtttgcaaaatttgatttcatacaactttttttgcaattttttctgcaaataatttaatttcaatcgttctcaatattatacagaatcgaaatttcgtgatttttgttctaaaaatacagtagtggtctcgacacgacacatctttgccaaagagtactgtagttataaatattcgttgcttccgaatttagttttctattaaaaataattttcaataaaaacttaaaaggaaaaatgtgataatttaaaaaaaaattgaaacaaattgatgaaaattctaaagcaaaaaaatttttaaaattacagttatcttcaaagaggcacattttttggctcaaaatgcgccaattttccagaaaaaaacaggatttccagcatttgttttacctcataatcttgatcagaaagcggtgcaaacgcattttcaagaacatcactagcatgagccaatacaatcaacgagagcattttcttatccatacgatgaacatcattcgtccatttccccagaaccgcttcttgcacttctttaatcaatttcgtcttctgatttccgtccgaaagtggatgcgtcgtaatttcaaaaagcaagaaattttgcttatcagtcgtcagaacacccttttcaacaagattcttggcgagtcgttcacgaacatttctcagttggtagcgaagtttcagcggattccacgtttctccagacaaatattcaatccagctggtcactgtctccggcgggtttgtctccttcatatggcgaagtgcctcgtcgagaatgacgtcaccagttggctcgctgcttttcacagtcacctgtaatattgtttgtttgtgcgatgcacgggacgaaatataatactataaaactttctttttcaattgaattcgaaaaatttcttttcggcggataagatggttcttattgatattacgcgaccacaaaattctgagaatgcgtattgcacaacatatttgacgcgcaaaatatctcgtagcgaaaactacagtaattctttaaatgactactgtagctcttgtgtcgatttacgggctcgactttaaaataaaaaggaaaatagaatattgttgtcaatattcgaaaaaagctataacaaatttcgaaaatcgagatcccgtaaatcgacacaagcgctacagtaacagaattaaagaattactgtagttttcgctacgagatattttgcgcgtcaaatatgttgcacaatacgcattctcagaagcctgtgctcccgtaatcaatatttatatctgaaactacctttctattaagcaaattcttgcgtctcattccgcctccctcgagttgaattcgtccacggagcacaagctcgatgagcacacatcctcggagccccgacgaaatgcaatcattccaaaacgatgtgtaaccttcacggtctttaaggccgagcaacaggatttgctccatcaaagtcaatcgggttcccttgtcattgtcttcttgatcc