Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_247.f   

sjj_Y47G6A_247.f RNAi JA:Y47G6A_247.f
Simmer:Y47G6A_247.f:Screen_A
Simmer:Y47G6A_247.f:Screen_B
PCR_productsjj_Y47G6A_247.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.10 Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.10 (3)
Overlaps_transcriptY47G6A.10 Source_evidenceePCR802WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_247.f948caatttagctgatttctcgcactaaaattcttttaaaattctgatttttctgattttctgcactaaaaatttgaaaaaatccaatttttcaggcatttttacattaaaactcccccaaacttcaattaaaaacctttttttttcagcaaacgcgaaatcccaaacctcatcagcgtcgcattccctcttctcttcggctattacatctatcgaatgctgaaaggcggtggagcagctggcggagccggaagagctggtggaggtggactcggtggaatgtttggtggattcggacaaagcacggctagagtcattaatcgagaagatatcaaggtgaagttcgccgatgttgccggttgtgaagaggcaaaaatcgaaattatggagtttgtgaatttcctgaagaacccccagcagtacaaggatcttggcgcgaaaattccgaaaggagccattctaacaggacctcctggaaccggaaagacacttctcgcgaaggcaaccgccggcgaggcaaatgttccattcatcactgtatcgggatccgaattcctggaaatgttcgtcggagtaggacctgcaagagtccgtgacatgttctcaatggctagaaagaactctccgtgcattctatttattgatgaaattgacgcagttggaagaaaacgtggtggaaaaggtggaatgggtggacactctgaacaagagaatactctgaatcagcttctcgttgagatggatggattcacaactgatgaatcgtcggtcattgtgattgccgccacgaatcgtgtggatattctcgattcggcactcctccgacctggtcgctttgatagacagatctatgttccagttccagatatcaaaggtcgtgcttcaatctttagagttcatcttggaccacttcggacttccctcgacaagactgtgctttcacgaaaactc