Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47G6A_247.h   

sjj_Y47G6A_247.h RNAi JA:Y47G6A_247.h
Simmer:Y47G6A_247.h:Screen_A
Simmer:Y47G6A_247.h:Screen_B
PCR_productsjj_Y47G6A_247.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47G6A.9 Source_evidenceePCR693WS150 Sequence/Annotation Release
Overlaps_Gene Y47G6A.9 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI34790343481512
Overlaps_transcriptY47G6A.9 Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47G6A_247.h2479aactcgatttttcatttttggctaattaatttcctccaaaatgagcactgcgaccaatcagcgatttgctccgcccatttttcaaccaatcaaacggagtgggcggagttcgaagacgctgattctcattttggaaggaattaaaattggaaattttgccaaaatgaaaaaaaaaacgattttgttgtggtttctctgaatataaaactattttgggaattttaagacaaactgggttactgtaatggagctagaccagtctacagtaaccggggcttaaaggcgcacgcttcaaaatgattaaaaaccttttgaaattccagatgagcggaagaggacgtggtggcggatcttcgaacactatgcgtagtgtcgccaacgcgttgggaatcgctcgatacgatatggcgaaaatgatgtcacagcagaagaatgagccgccacagttgtatccggtacgggctgtggagcaccggaataagaatttgaaattttttgaaaaaaaatctggaaaaattgaataaaaaaccataattttatcacccaattttgcgacttttccgtcaaagtgtcaaagtgtctggtctcgacacggcaattttttattagttcagaaaaggtgtgcgcctttaaagattactgtagcttcaaactttcgtttctgcggaatttttatcgatttttttctctcgatttgtaaacattttattgtttttattactctaatatttcagtttgttaataaatatatttttatcgaaaaactaagaaaaatatatgaaaattgcgtaaaaagtttgaaattacagtactctttaaaggcgcacacctttttgcatttaacaagtttgtcgtgtcgagaccgggtaccgtagttttagcagaaatttctcgttttttcgaattccttccagaatccaaaaaaaaagaagccaattcttcaactgaactagtcctaaatttacttgaaatctttgaaaatcagtattttaatgaaatttgtatttttcagaaagtgcaacatgaccccgttccacttgaaatgacgactgacatgctctacgtatcccgtttaaaagttgaacttgatcaacgaatgcgtgattcacagttctttattgaagcagagaaagacgacgaaattaagcgttatttggataaatattcgaatattaagagggaaaagcttagcattggtacggaaatctaggtgaaattgtgtctcaatttcagaaaaaacaaaaaaaaaatttgaaaattcaactttttggctaaatgagaagagcggccaatcagcgatttgctccgcccatttttcaaccaatcagatggaatgggcggagttggaagatgctgattggtcggagagttcgaggaaattagccaaaaaaagattgaatttttctattttctgtagcgctttttctgaatttaaggcgattttttaaccttttcaaattcataaaatccattttagatatgtcccatatgccgaatgagctcatttggcgccgagctagctcgaaatccaaggaatctttggcaaaacgacgaaaagtcgccaatgacgattcgatgatcaaggagaagttgaaaaaattggaagaaaaagaagcacagaataaggatgatgatgatgacgatgagaaggctgataatgatgtaatagatattttaatttcagatttttgacattttatatgggacagggcattttttagcacttttttttcagaaaaaatcgaaaaataattttcagaaaaatcgaagtaaataagtagaagaaatgcacggaaaatgacgagaaaactaaaaatcgaaatttttcgttttttcgagaaaaataatcaaattttcaataatttcgggttattcctcatgaattgcaaaaaaaaaatattttctcatcaaaattggcatatcttttgatgaatctagagttttctcgtccctttatttctgaaaataaaatttaattttagttgaaacatttggaaaactgctcaaaaaatgttcgaaagttggaaatttctaattttcagacgatttttgagtggtttttcaattgtttcaactaaaataggagctattttcagataaatcactacattttaatgaaaataattggaaaaaaatcatatcttaatttcagaaagactctggcagtgaaaaatccgcggcagaagaggaggagaatccattatcagatgatgacaatcaggaggaggataacgattacatctcggcttactttgataatggagaaggatatggggacggcggtagcgatgataatttggatgccgatgatatttaaagaatctccggacactttttttgttgtttttgttgtttttctctcaatttttgaatatcattgttaaatatatgaatttatttattgattttcccttaaatttaacccttttattcgttattagcttcagatttaaccaattggttcagaaaatcggttttt