Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47H10A.f   

sjj_Y47H10A.fRNAiJA:Y47H10A.f
PCR_productsjj_Y47H10A.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47H10A.5 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene Y47H10A.5 Source_evidenceePCR899WS150 Sequence/Annotation Release
Chunk_score Abs_score815
Max_abs_score815Y47H10A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1209588912098119
Overlaps_transcriptY47H10A.5 Source_evidenceePCR899WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47H10A.f2231aaaacgtagcagtcaccattgttcttaacatattcctcaaccaaatccaggaaataacaaacactttcttctccttccaatggtttccattcaggtgctgggtccattagtactttcttcaaacattcctcggcggcactttctggaatttgattctgttcgagtgtttcaacctgaaaaagttgaaattattttaaattatagctcatcaattaatactgtatgaccgattttgaaattaggttttgaaggtggagtagagccaatacaaattttgcttcaaatgacagaaaatagaccctaaaaaccgattataactgtagattataaccgaattaaatttttttttcaaataagtgacatcattttttatatttttgcgtttttttggctaaattttttggtttttcttgctgtttctttctgtatttgatttacaactatgtttgtcaaactttcaaacaattttccgaaaaaaaaaatatatatctattaaatagtcgatgtttaagccaactttgaaatttccgccaagttctttcaggttatcatgttaaatttaaagaaaagtatctaaaaataacgaacagagttttaaattaaatacatacagaagaaaaaaagcaagaaaacagaaaaatttaatcgggggaattcaaatttaactcggacgtttctttgatttttgaaaaatgagaaaaatcataaaaaattcagaaatttttttaaaattattaaacagttatattcggtcgttgggatctagtttctgtcatttacacaaaattgactctactccacctttcaggtgtctacaccattttcatactgagtacttgaaagtggtcaccatatattccaagctacgtagttcgctccaaaaatcaattttccatatgcaaaatcacctgataaacggagaatggaggccattctttaggccatgtggttttggggtcatttggacattttccagttctggagccaataatcaaaacgtcagcttttccaaaaacagcttgccagtaaaacatacagcttttcgttttccagaagtgctcagttaatcctccacttagtactttcagctcataatgcatacgattgactgaaaacaagtattattcaatatattcaaaactagaactaaagtaagctaataatttaccttcattgtctaccgcgtcaatttgtccggaatacaacacactgtgaaccccctttccacgtggaatctccgctatcatcactgcttttctcaccggttcattttcgtttattggatcatcagttttagtgcaatgatgctcaaaagctgctccaaagttttggttaacagattcatcctcattaaacttcagcagataagttgttccattccatctaaaaagatgaatagcaagtgatccagttctagtaagcgcaactaatagttgcttattcgttacaaaaccaggttgttcgtcttgtaggcaacttgtttgactgatatagtccagtagagactccatcatcaattctccttttccagaatctaaaacctcgatgttcatatttggaaatttttccttgttttgcattggtgttaagcatgctaggttaagatttttgggtagacgaccaggtgtagctttcctgaaattaaccacttaaaagttgttttgttttagcttattaacttgaaacagaagttggctaaactttggcaaaacttggattcaggctgcaccaaagtttaacccaagtttcactcaattcttgccaaactttggcccaaacttttcttgtttcttttcaaacttgggtagaagtttggcaagagttgggtgaaacttgtgtttaactttggtgcatcctgaatccaaggtttgccaaagtcttgcccaacttttgcccaagtttagccaatttctgatccaagttaatatttgttaggcaaaaattaggcaagaagctagagccaaatgccgagaaacttacatttcactatcccgatgatagtatccgatagttttcactcgaatcttagttaactccattggtacaattctatgtgcagccgatagaatttctaactctcaaattttgcttagcacaccttttatattaataatcactgataagaaaccagaaaaaatggtgaatttcaaaattagtcacctattttgaaatagtggtatagttttgggtgtgtacatagaactttgtgactttaggtgtgctcatgaacc