Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47H9A.1   

sjj_Y47H9A.1RNAiJA:Y47H9A.1
PCR_productsjj_Y47H9A.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score556
Specificity_index0.482
Rel_score0.93
Map_statusBest_ePCRI1161888611620335
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598Y47H9A.1
Specificity_index0.518
Rel_score1
Map_statusBest_ePCRI1162301911624468
Overlaps_transcript C17D12.3 Source_evidenceePCR703WS150 Sequence/Annotation Release
Y47H9A.1 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47H9A.11450aactcaccccagtaggctttaaccaaaaaaccgctctcaagctccctacattccatacacttttcagcatgcccaaatactttcatattcttgtacatcttgatctgaaattgatgtttactagctatgtagtagctataagaatcaccaactcctaagaaaagggtgtcagcttgtggcttatcaatgatcaaatcctggtttaccggaatttccatgcaattctgaaaatttattggtgactgtagcacttcaaaagattcttcataacaacctcaaaagtgtccagacaagcctcggcttttcctcctccgttgagtgtctgatttattcctaccattcgaattaccagcgtctccaatactttaccagtagacgtcaagttgaacttccagtagatctaaaacgaatactataggggtaatgtagcggtactgtagtggtactttaggttacagtagtgatactgtagtggtactttattggtactatagaggtattgtaagggattctgcaggagaactgttggaatactatagggatactgtaggagggccgttggggtactgtagggtactgtagagctactggagtgatagtttagaagtagtttagaggtaatgtaagggatactgtatgagtactgtaggagtactgttgtaatactgtaggggtactgtaggggtactgtaggggtactgtaggggtactgtaggagtattgtaggagtattgtaggagtgtcgttggggtactgtaggttaagtagtggtactgtagttgtaatttccagtagaactaaaacccaataagtctacgtttgtgaaactcaaacataccattccttcctcattacgttttttcttttgcaagtatacatcgtatggttcttcatcagaatgccgttcaacatttttcacgataaatggtttaaccgctgatccatctttgttagtgtgcgaatactttccgcgcacaatttcgtacttgaacgcaaagtatctatgatttcccaattggataggttcgttctgtgttgttaatgtctgatggtcaggctctagatctgaaaatcgggagttatcataggattttagagggtaaaactaaaactcttaccagaatcagttgaagagcccccgaaaagtgcaaccgctaaaaaaaaagaaaataaaaaaaagagagttccaacgaggaccaaagctacgatctttttagaaggatgcgatcttgcttccgcttgcgatcttaaatttgctaaatttcttacggagaagtgctaaacttagtttaaattattataaaaaaacttacatgtttgttccgctcagcggcagtggagagtatacaggattttgcgatgacattagttttttgaaatgtgtctctaaaaatagtcaggtttggtttgtaaaaactttgaagtgacccaaggtcaagaaggagataat