Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y47H9B.2   

sjj_Y47H9B.2RNAiJA:Y47H9B.2
PCR_productsjj_Y47H9B.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47H9B.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
Overlaps_Gene Y47H9B.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
Chunk_score Abs_score646
Max_abs_score646Y47H9B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1174411511745597
Overlaps_transcriptY47H9B.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y47H9B.21483tttcaaacgtgtgagttcaaaaaatttttcattcccgttttcgaaatgaaaattcaatcaataatcactatatcaacgttcattatcatcgtcgtctcctataatgagctgacagctgaggaaaatgataagaggctcgagacatgtggaaatgagcatattggtgagtaagattttttttggtgagcagccgacatcaatcctgtctagcgatagccgcttttctgcattttggagtaaaatcaaaggcttgatgtttgcacgataagcatcgctccatactttttgggtttcccgccactcgttgtcggaaagccggtcaaggctccgttacggctcctaaatataagacctaggccactattatccgataagacagtatttgagcccgtccacagaggaaccggactattaggcaaaggtctttttggataaggtgtcagagtgtccaatttcggattgatctacgttgatctacaaaaaagcgggagttcagacgcagagttctcaactgattttacacggttaagaacgtgctgacgtcacattttttgggcaaaagaatcccgcgtattttgtagatcaaactgtgataggacaccctgacaccacgtggcgcccctcgtaacattttgaataattttttttaacgagtatattttcagggaaaccatcgaaaaactcgataatctctcctgtctcctggcttaccaaattgacaagatccgaaatttctgctccggcagttataatatctcctcgacacttgatcacttcttcacggcttttcctcacaaaatcagcttggaaaaatagcggagattcgattgattgtgatgacagcataaagtaagaccgatagtgatctccgatctttacgaaatttttttcaggcacttggaagttccggtaaacaagctctcggatgtgattgagccgtgcctttctcaaaaggagaattgctccccgaaagtgatgaattttgccagagcatatattctgaacttttgcaaatcaacattggtgcaaaaaagagtgtactccttcccaatgattttggagcttgatgagaatttggaaggcaactcaagttatccatgtctagctgatggtaaagcttatatgactttcaggccaatcaacgcctagctccgcccactgctagaccaatcagcgggctcggtcgtcgctgattggtctgagtttcttttttccagaatcaatcaaacttgccaaaggagatgccattgacgcttatggatgtacaaacaattcggaatggaagcatcgaaaagtgaatgtcggcgccggtgttagtccggatattctatacggaactgttccaaataccgaaaagggattcgatctgggacctctcacaaaaaatgattccggcagagtttggatggttggattcgatttagcaggtgagcaaatgtctgcatgccaacgagactgtttacattatgcctgcctaccttgt