Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48A6B.5   

sjj_Y48A6B.5 RNAi JA:Y48A6B.5
Simmer:Y48A6B.5
PCR_productsjj_Y48A6B.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48A6B.5 Source_evidenceePCR627WS150 Sequence/Annotation Release
Overlaps_Gene Y48A6B.5 Source_evidenceePCR745WS150 Sequence/Annotation Release
Chunk_score Abs_score661
Max_abs_score661Y48A6B.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1100887911010429
Overlaps_transcriptY48A6B.5 Source_evidenceePCR745WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48A6B.51551caatctaaatcacagcaaatcccgttctaaaccactttcagctcagaaaatgctcgccgaaacgcttgtggcgcccggcgacaaggttctcgacgcgattggtgaatatcgaatggggaagggattatacgaggcgaatcgaaggatcttcgcgtcggtagccggttttgtcaacgtttatggattcagagatgtaattttcgcacaaatcgcaagcgtggagcccgaaaatttccgttttttctgcagaaatccgacaacctggtgcaagtgatcgaagttcgccgcagcgaagatcagctcgacaatgagcttctcccattccacggagccatcgtcaccgccaaagtgatggctgtcggattacggtagagcagcttttcgttgctctgaaaaccgacagaaaatattgcagattcgccaaatgtgacatcatcagtatcggcgataaggtttacaagaagcggttctcggcgctgctgccgaaaaagaagctgaggccgctggaacctgaattggttggattttgcctggattgtgggtctcgccacgaaaaaattaagaatttctgcttacaaatgtgggaaaaaccttttttttagcagaaaattaggtttttttgcgaaaattcttatgaaatttcgcataaaaatggccgattttaaggttttttgcagaaaagtcgtcaaaattcctgatttcttgtggaaacatcggaaaaacattgattttagactgattttcactaaatttcaactgaaattctcggttttttactcaaaaaacaaatttccctcttttttcttattttaaagcgattttcgagcaaaatttttttttaaacattagatatgggccgaaatcgtggcgagacccaaactgagaacccaagtagtgtatcgcacagaaaaagaggcggagcttaaattcgcaaccctgcggcacggggtttccttcctttttcgcatgttttacactgatttttgttgatttttttcaatgaagtttagattttactaactaagaagtgaaattttaaaaaatcaataaaaaatgcagtagaaaactggcaaaaaggtggaaaaaccgtgccggagggttgcgaaattacgctccgcctctttttctgtgcgatactgctttagaggcaaaaaattgaaataaagagcattttttgcagagtgagccattcaaaaactttgtgcgacccaacgactacattctggcaaaagtttgtgaagacgccgaaatcaaggacaaattcgttttatcgatcgccgaagacgagctaggcgttgtgctgtgccgtggacgatttggtgaaccaatgcaaaaagtcgactggaatacggtggtctcgacacgaaccggcaaaacggaacccaggaaaatggccaaagttccgcaaaagtgcacattgcccacgcaatcggtggcctgaataattatcctctctgaaaagatctttgaatcgttatatttttgtacttttttttgtgtttttgggggccattgtttcgaggaaaaaaaagtcataattgttcccccact