Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48C3A.b   

sjj_Y48C3A.b RNAi (5)
PCR_productsjj_Y48C3A.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48C3A.1 Source_evidenceePCR348WS150 Sequence/Annotation Release
Overlaps_Gene Y48C3A.1 Source_evidenceePCR348WS150 Sequence/Annotation Release
Chunk_score Abs_score264
Max_abs_score264Y48C3A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1326006513261639
Overlaps_transcriptY48C3A.1 Source_evidenceePCR348WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48C3A.b1575gtgaacaatttgggtaattggaaagtgtcttcgggaatctttatacatccgacaaattcgagtatgtttatattctgaatcaatatacattctcaatgtcaacgggggacgccaggaattgtcagcaaaaaaatatatttatactctagtacttaatgtcatcattattgttctagttttctcacaaaggacaatcgatttatataaattttccatcaggtaaagggcaaaaaacagctgtgttttggtggaagaaaatgggttttgcagattccaagaccagcctaagcctacgcctaagcctgagcctaagccaaagtcttagaatatggctaagcctaggcctaagcccaagccggtacagctgtacatacaaaattacttcatttacatatcttttcaatacaataaacattttttcgtttacaatttaattctcattttcagaaaattccccaaaattaatgcaattttgtttttttctaattttattgtattttgacatttgcattttcaagaaaaatcaccgttgaccgtaatccacatttaaaggagcacgcacttctactgaatggtctcggcacgctaacggaaacgttgtgtgtgtgcctttaaaattactgtgcatttttttaaatttttttcttggctgctttactgatgtttttttctcaattttttcttgttttctttgttactaatttaaattaaaaaaactattttcagcttatcacagcaaatcggagcgaaactcgaccgcgataacaggaaaaagtcgaaaagtgagttttttgccaaaatatctcgaaaaactcatattttgttttgaaaacagatgcaaataaaaagaaatacattgtcactctttcccaattctcattttattgatttaaatcaaaattcaactaaaaaaaggtcacaaaatttatgaaaaactcaaaatttctaaagaaaattcaaatattttcagcttcactcgaatcatcttctcgacacgattctgttgaaggatgctcctggatcgaagaagattgataaataattttttccccgattttttattgtttttcccccaaaaaaaaataaatcaaattaatttgatttaaaagtgttttccctttcttctgtgcccacaagattttccagattttagtcatccgggagtccagcgactgcagcggtcaaaggtgagcacattgttattttaaatatcagattttcgaaccaaatttttgaaatatttcagccgccgccgtcagctggattccattgaagtgtgacgaaggaattaaggtttgcttatcaaaaaaaggttgatttttcctaaattaatttttctacagagctcgtcgatccggacaattccgcagaaatcaggaaatcaacagacggaatggctccggagtccaatggagcgcacaagcattcgccaatctgagatccacaatgcggctgggctacggatgctgaatagataattaaattgcaattttaaattttaaaaacgtttggaacaagaccgcccgtttctccgactcgcttaggtacactcatctacaaaaattcgttttgcga