Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G10A.e   

sjj_Y48G10A.eRNAiJA:Y48G10A.e
PCR_productsjj_Y48G10A.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G10A.3 Source_evidenceePCR305WS150 Sequence/Annotation Release
Overlaps_Gene Y48G10A.3 Source_evidenceePCR309WS150 Sequence/Annotation Release
Chunk_score Abs_score267
Max_abs_score267Y48G10A.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1347360713474539
Overlaps_transcriptY48G10A.3 Source_evidenceePCR309WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G10A.e933caaaattgtgttaaaaatggggaatttacacaaaaactgctaattttaagaaaaaaatagtctaatttcaaaagatttcaatttgggtgaggctgtgggatttttgtagtttgtagtctctgagcctcaaccaaatcagcagattgatttttttttccaaaaattgtgtgaaaacatggaaaaaggcaagaattttcgagaaattatacttttccggaagcggctgagcatccatttcctgtcccggagcattcacattgtagatgcagaatttgtcggcgaattcggcgatcgacacgaattggaaaaagttttggaaattgctttccgctgcaaaatgtacgattttaattcaatttttctgctaaaagctcacaatcaagcccaagatcatgaaaagtgaccatcggaacctttttcggatcgttacggtctccgtaaatcgacactttgatagctccaaaggccgtgttcactttttcttcggtgaaattgttggcagattcttccattagaggctgcatgtcacgtgtaaatgagtgcatttctattgatgccatggttctggaaaagtggtatttaatagaggaaatataaaggaaacagtgaaaatagagagaaaatcgagaaaaattagagaaaatccaacaaaatcgatattggttgaggctgagagactacaaactacaaaatcatctgagcctcaaccagattttattcgaaaaaacatctgacttttacaactaaaataaagtgaaatacgtcgttttggctgctcagaatcaaagaaaaaaatagtttgtatgattgaggctgaggctacaaactacaacatcatctgagcctcagccagatttcatttgaaaaaatttggcgtttacaacttaaattaagtgaaatgagtagtgttggctgctaaaaaccaaagaaaat