Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G1B_51.a   

sjj_Y48G1B_51.aRNAiJA:Y48G1B_51.a
PCR_productsjj_Y48G1B_51.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G1BR.1 Source_evidenceePCR642WS150 Sequence/Annotation Release
Overlaps_Gene Y48G1BR.1 Source_evidenceePCR644WS150 Sequence/Annotation Release
Chunk_score Abs_score560
Max_abs_score560Y48G1BR.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI257543259548
Overlaps_transcriptY48G1BR.1 Source_evidenceePCR644WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G1B_51.a2006aataacacttccatcctgctcaaaaagtccttccagtgcactttgatcaaatggtgtttctccgtcatctccagcttctgatgggtcacttactgcgacggtggattgggttgtggtcactgtaaaattggaaatttggaagagaaaaacctcggccattggtgacgtcatacttttcgccacttcttcgaccagctataatgccacgcttttagcaagttttatttttggtaaaccaaagagcaaccaattttaaaactgtgtctccaggtttaccgccaacttaagggcgtgtccgtacagggtttgcccgttttatgggcgtcgcttaataaatcatttttcaagttttcagtttcgtggaaaattagcatccgggaaattgagtcataagtatgacgtcagcagccgcgcggcttcccatgacgtcactccatgcgctcccccgacgtccctctaagacgtcaccacctctcacctggtttagtgggtcgtgtcatctccttctctttcaaaactcgtctatcagcgacctcgtcaacctcaatcggaagggagctgaacgtaatcacctccaagggagtggttggcatcatttcagtcgtattttcagcggcgagagttgttttctcagtggattcatcctgatcctccatactatcatcttcgattgttgcctgggagaagttgaacataccgccgtcaagcggagttattggggagaagacggacgttttctggattgggttcacttctagggaggtgtcgttcggcgagagttcgatcatttctgtacttgtctcgaaggtatctgatctgaaagttatgacatttttttggtggtggcctgggagaaaactaggcctcctggcctagaaatctcaaacctcggcctccagctctcactagctgacctaggtttactaaacatcggcaagacctcttttcgactactcccttacaaatttttaacagtttttcatcacacaattttccgattcttacccctcattcatcatttcttctttcggaacagccatcatcggcatatcatcattatcaggcattacgggtgtcgttgtgtcttttgccagcggtttgtcgaacacatcttcagaattttcgtcttgcgcgaaggaaactgaaaaagttaaattacattttttctaggccaccaggttttgcattttggcctagaaaatgaaatgagaagctagaccatgtgggtttattgcgaggaaaagctatcccacgaaaacttttataagcgtctagaaaagtagaaacctcggccaccaagttttgcactgtgacctaaacaattttggtaaaataggccagcaaaatttccatgatggcctcaggaaaactaggccattaaggtttcttccgttacctagaaattttgtaaacctaggtcaccagggtttctaggccacacaagaaaagctaaaaaccaacatttcagatcggtctggaaaagtgcaaaattaagccaccaggatttgcatggtggtaaaaaattggtaaacgtgaactagaagtttatcggtcatcaacttacgtgtcgttgaaaatgcaatgaatagaataaaaccaaatggtatgcgcatcgctgaaaaattgcaaaaattaatttatgttttggaaaatcagaaatcggagtgttcattttttatgggacaagataaaaagagatggagaaaatttatatgatatatcaggtcaaaatgaccttcggaaattgggaatgaaaaatcaaaattaattcgcgtggaactggttaagatgatcgaagattgaaaaatttgacagaaattgcaacaatactaatgcaaaaagttggtaaaatatttttttcagttttcagaaaaatcgatagcaaaagtctttttttttaaataaaaatttctgaaatattttcgctgcgagacctaaggtgacaaattggattaaaaattttatgtgcccattaagagtttttctggaaactgaagagaaagtcg