Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G1C_55.c   

sjj_Y48G1C_55.cRNAiJA:Y48G1C_55.c
PCR_productsjj_Y48G1C_55.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y48G1BL.1 Source_evidenceePCR773WS150 Sequence/Annotation Release
Y48G1BL.4 Source_evidenceePCR240WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcript Y48G1BL.4 Source_evidenceePCR240WS150 Sequence/Annotation Release
Y48G1BL.1 Source_evidenceePCR773WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G1C_55.c2253cgattttcacacattttcactcatttgcactcaatttttttgcagaaaaatgtcaatggatattgttatgaagtcagatgagcagccgttcatctctgcgcctgtatgctttaagtaagctccaatttttgttattctggcctaaaattatttttttgatttccagaacgttcgcatttttcgccaaagcatccgcagaggaatgcaaacttctcttcgggctccaacgctcgagaaagtttccagcaggccacggggctctcggagaagatcacggaagacatttaccgccaaattgagtaggtttttcgatttttttacccttaaaaactactatttttctattttccagcgtctcccacatttcgtcgatggtcttcaacagagaaatggacggtggcatcgagagaaatcggctcggctcgcaagcgattctgctcgacgagaactccaggcgccgcaatccacagttcaaatcgatcgcgctccgctctccgctacgatcacatcgatcatagagcgttggcaaggaaatcgcctcatctgatgcctccgacttttatcaaagaggaaattatggatgatgagctcgacgaggtgaaggaagaagtggtttccgttggagaagccgccttgcccacgccaaaagtcgaactgaacatggaccatccggaaaaggacctgatcatcagcatttccgtgtatctcggctacacccgtacccttcaataccacgagattcgcctcggacgtttgatgaagatcacggatcggctcgagctcaccggagatcacacgcttcgcgatctgaaaaacgcgttctcgtgccccatcgatttctcgttttccgacgattttagcgagaaaaagccgtcgttcaaggatatggcgaaaaataagtggccgtcgacgatgttcttcattcatgacacgttttatatataactggaaataatttaatatttttcgaacaaatttgaaaactataaaaccatcttattttgataaaactccgccgctgctctctgaagcaatgaactgcaatcagacatcgaagggatcagccgatcacggaaccaacctgccattgagcttctgaaaattaatatatttgattcaatttattgtacgaaatcgtttttacccatatctgtgagctagcaagctagctaatcgtgattaattgttgggtattccttcgcgttcttcagcttctccacaagcaaaattcttgtctgctcatcacaaatgatgtcatcagcatcgctctgatcttgaaaatcctgaaattataacattctagagggtttctgatgagaatagttaccttacaaccaacaccaaatacgttcttcattatggcatccggcagctttccataatcgcagaagaagtgctcggcatcacgatcggatgctctatttgggaaacgaccgatgtagacacgaaccatgttgagtggccgagagagggatcatctgaaacatttaaatgttaactaaacaggagtttagaaactttaaaacaacctaacctccgtgataacgtagttagcttctcgagtgagcttcttcttcaaaataaaacagaatgaaacaagaatcaagtgggtaaaattgtaaaatgaagtatttcagacattttcgctaattttggcagtaaaaacctataattttggtaaaaatcgcttgtattctgaaaaaagaactcaatatttaattttttataactgattttaaagagaaacaaacgaaatatatgaaaaaatcgaaaaaatccctgaaaaaggcctccgcaatattgattgttaaagggacaccgactgttcatcgaatgggtcccgccgcgattgtccatttcgagcgcttttcgcgattttttactactgtaaaaaagtgtaggaaaatgtcgaaaaatgtcgaaaaatgacgtcacaaatgtatttaaatacatgtttttattgttacttgaataaggcaaaatatgtatttaaatacactttaattttccgacattacttgaataaccccataaaaaaccccgaaaaaattttttttttgtgaaaataaccagaaaaatacatgttaaaacaattttgtgaacaaaaaactaaaaaatattttttttgcagagatgaatcccacgtgaacgtcgaatttccacgccgcctcgtcgaacggaatttcagaagaatcgcatgtgacacgtgcaaggaggcgtcggctcagtgagtacagaaaaatccatggggat