Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G1C_55.e   

sjj_Y48G1C_55.eRNAiJA:Y48G1C_55.e
PCR_productsjj_Y48G1C_55.e
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y48G1BL.1 Source_evidenceePCR96WS150 Sequence/Annotation Release
Y48G1BL.4 Source_evidenceePCR240WS150 Sequence/Annotation Release
Overlaps_Gene Y48G1BL.1 Source_evidenceePCR96WS150 Sequence/Annotation Release
Chunk_score Abs_score75
Specificity_index0.18
Rel_score0.424
Map_statusBottom50_percentile_ePCRI217114218231
Y48G1BL.4 Source_evidenceePCR240WS150 Sequence/Annotation Release
Chunk_score Abs_score177
Max_abs_score177Y48G1BL.4
Specificity_index0.424
Rel_score1
Map_statusBest_ePCRI217114218231
C06A5.10 Chunk_score Abs_score93
Specificity_index0.223
Rel_score0.525
Y76G2A.2 Chunk_score Abs_score72
Specificity_index0.173
Rel_score0.407
Overlaps_transcript Y48G1BL.4 Source_evidenceePCR240WS150 Sequence/Annotation Release
Y48G1BL.1 Source_evidenceePCR96WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G1C_55.e1118cgtttttacccatatctgtgagctagcaagctagctaatcgtgattaattgttgggtattccttcgcgttcttcagcttctccacaagcaaaattcttgtctgctcatcacaaatgatgtcatcagcatcgctctgatcttgaaaatcctgaaattataacattctagagggtttctgatgagaatagttaccttacaaccaacaccaaatacgttcttcattatggcatccggcagctttccataatcgcagaagaagtgctcggcatcacgatcggatgctctatttgggaaacgaccgatgtagacacgaaccatgttgagtggccgagagagggatcatctgaaacatttaaatgttaactaaacaggagtttagaaactttaaaacaacctaacctccgtgataacgtagttagcttctcgagtgagcttcttcttcaaaataaaacagaatgaaacaagaatcaagtgggtaaaattgtaaaatgaagtatttcagacattttcgctaattttggcagtaaaaacctataattttggtaaaaatcgcttgtattctgaaaaaagaactcaatatttaattttttataactgattttaaagagaaacaaacgaaatatatgaaaaaatcgaaaaaatccctgaaaaaggcctccgcaatattgattgttaaagggacaccgactgttcatcgaatgggtcccgccgcgattgtccatttcgagcgcttttcgcgattttttactactgtaaaaaagtgtaggaaaatgtcgaaaaatgtcgaaaaatgacgtcacaaatgtatttaaatacatgtttttattgttacttgaataaggcaaaatatgtatttaaatacactttaattttccgacattacttgaataaccccataaaaaaccccgaaaaaattttttttttgtgaaaataaccagaaaaatacatgttaaaacaattttgtgaacaaaaaactaaaaaatattttttttgcagagatgaatcccacgtgaacgtcgaatttccacgccgcctcgtcgaacggaatttcagaagaatcgcatgtgacacgtgcaaggaggcgtcggctcagtgagtacagaaaaatccatggggat