Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y48G8A_3945.c   

sjj_Y48G8A_3945.c RNAi JA:Y48G8A_3945.c
Simmer:Y48G8A_3945.c:Screen_A
Simmer:Y48G8A_3945.c:Screen_B
PCR_productsjj_Y48G8A_3945.c
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48G8AL.8b Source_evidenceePCR480WS150 Sequence/Annotation Release
Overlaps_Gene Y48G8AL.8 Source_evidenceePCR622WS150 Sequence/Annotation Release
Chunk_score Abs_score559
Max_abs_score559Y48G8AL.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI11565351157538
Overlaps_transcript Y48G8AL.8a.1 Source_evidenceePCR622WS150 Sequence/Annotation Release
Y48G8AL.8a.3 Source_evidenceePCR604WS150 Sequence/Annotation Release
Y48G8AL.8a.2 Source_evidenceePCR616WS150 Sequence/Annotation Release
Y48G8AL.8b Source_evidenceePCR543WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y48G8A_3945.c1004ttggacctgcgttctaatttttatttctgaactgtattattttcaggtaatcttccttgtcgaaatgacgaaggttcactactcccgggctccggaaaacagcaccaagtcgtgcaaggctcgcggatccgatctccgcgttcacttcaagaacacccacgaggccgccatggctctccgtggcatgccactcagacgcgcccaggctttcctcaaccacgttaaggagcacaaggaaatcgttccattcagacgtttccacggaggaatcggccgtgccgctcaaaccaagcaatggaacaccacccaggggagatggccagtcaagtccgctgacttcctcctcgatctcttgaagtgagtttcacacctattttctcaactcaatttaaaaaaatttttgttaagtgaaagataaaaaattgtttatttttccaggaacgctgagagcaacgccgagtacaaggggctcgatgttgaccacctcgttattgagcacatcaacgttcaacgcgctgccaagctccgcagaagaacataccgtgcccacggaagaatcaaccgtaagttgatttccgctctttgaagcaaatttttctttgtgtgcccaaaactacacgcaagtcttagcggtcggttttctgcggcaatttactttgaaatctccgtagaatattgtgcatatttgaaaacttcaaaattttttaaaaagttttctcgctttaaataaattaatttcagcatacatgtcttccccatgccacatcgaggtcatcttggccgagaaggaggatgttgtctccaagccaaccgatgatgccgcaccaaaagtcaagaaggagtcgaagagaaagcaacgccgccagttggcccgtggagaattctaagtaaactcttgttgataaatgttttgtttgttcgcaagtgtttcccgttacacaaaatacacgaaacagtattcttcagctttaaacgtatctcggtaatcaagaaagtcggtcgta