Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y49A3A.2   

sjj_Y49A3A.2 RNAi JA:Y49A3A.2
Simmer:Y49A3A.2
PCR_productsjj_Y49A3A.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y49A3A.2 Source_evidenceePCR988WS150 Sequence/Annotation Release
Chunk_score Abs_score946
Max_abs_score946Y49A3A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1435551814356605
Overlaps_transcript Y49A3A.2.3 Source_evidenceePCR890WS150 Sequence/Annotation Release
Y49A3A.2.2 Source_evidenceePCR988WS150 Sequence/Annotation Release
Y49A3A.2.1 Source_evidenceePCR988WS150 Sequence/Annotation Release
Y49A3A.2.4 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y49A3A.21088ctcgtgaagcttccatctacactggtatcacccttgccgaatatttccgtgacatgggtctcaacgttgccatgatggctgactctacctctcgttgggccgaagctcttcgtgagatttctggtgagttttaatccgtttaaaatatactcatatttgaaattcatatttttttcttaatatttttgaaatttctctgaacattttcaaattttcttttcaggacgtctcggagaaatgcccgccgattccggatacccagcttaccttgccgctcgtctcgcttccttctacgaacgtgccggacgtgttaagtgtctcggatctccagaacgtgaaggatccgtcaccattgtcggagccgtatcaccaccaggaggagatttcgccgatccagtcacatccgccaccctcggtatcgtacaggtgttctggggacttgacaagaagcttgctcaacgtaaacatttcccatctattaactggcttatttcctactccgagtacatgcgtgctcttgaggagttctacgagaagaactacccagagttcgtctcactccgtaccaagtgcaaggagatcctccaggaagaagaagatctttccgaaattgtgcaactcgtcggaaaagcttccctcgccgaatcagacaaggtcacacttgaggttgccaagatcatcaaggacgatttcttgcaacagaacggatacaccaaatacgatcgtttctgcccattctacaagactgtcggtatgctcaagaatatgattggattctatgacttggcccgtcatgctgttgaagcaactgctcaatctgataacaagatcacatggaacgtcatcaaggatagcatgggagatttgatctaccagctttctgccatgaaattcaaggatccagttgccgatggtgaagccaagattcgcaaggattacgaagatttggcagaggctatggctaacgctttcagaaacctcgaggattaaattaatgtttttagaaattttaaaattgattctcttgtttgtttctgttttcgcctccccgctagattctgttcagttttgctgagcgtgtacttttt