Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y49F6B.r   

sjj_Y49F6B.r RNAi JA:Y49F6B.r
Simmer:Y49F6B.r
PCR_productsjj_Y49F6B.r
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY49F6B.1 Source_evidenceePCR532WS150 Sequence/Annotation Release
Overlaps_Gene Y49F6B.1 Source_evidenceePCR532WS150 Sequence/Annotation Release
Chunk_score Abs_score427
Max_abs_score427Y49F6B.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII35060353508529
Overlaps_transcriptY49F6B.1 Source_evidenceePCR532WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y49F6B.r2495caattttcccactcaaataccaaaatttttccagattcgccgacaaattccgcccacacatatggccatcagtgaaatggacagccttggcgtttttcaagcgggcttttcttgtctgggtgccatcagacacgtcgattagggtaaaaattgaatttttagctgaaaattagtcaaaatcgccgaatttttgatttttaaacgaaaaaacctatttttcgggccatttttgcccaaaaattgtcaaaaattcaattttttcatacaaacttccgaattttttttagttttaaacgaaaaaattctgcgatttttggtgtaaaattgactaattttcggcttttaaacgcaaaaacctatttttcgactcaattttgtgtaaaaattgccaaatattttgttttaaacgcaaaaatcggcaaaattttgatttttttaacgcaaaaacttggatttcaactcattttcactcaaaaatcgctaaaattttgatttttaaactgagaaaactcaattttctgccgatttttgcccaaaattccccgaatttccaacattttccatcaattttccattaaaaatcttaatttcagatggtaatgatggcttgcttctacttggcaatgaaaatcgacgaattctacattacaatcgaagatttcgtgaagaatatgaagtaagtcctgataatcgccgctggcagctactcattatcagaagttacagcgttggagaacctcgacaaaatgccgaacggattttgaagctggagccggagcttatgaagattctcgactataatttgactgtacattgcccgtataggtacggaaaatcgggattttccagcaatttccgctgaaaatactggaaaaattcgaaaatttcacgaaaaacggagaaaattggcatttttccggctccgagacctcaaaattgcttaaaaatccaatttttgtccgaaaaaattcaatttcataaaaataagaatttagagctgaaaatgcgctataaaatccttttttttcttacaaaataccccagaaaacctcgatcttggttcaatttttgagaaaaatctgaaaatttcgtagatttccactagaaaatgtgaaaaatctcaatttgcatacgaaaaagccaaaaaaatcacattttccagcttaaaacaaccctaaaaatgacaattttcagactagaaaagcctataaatctcatttttcaggcaaaaaacctaaaaaaaaatttccatttttcagctgaaaaaagcccgaaaaaatttcatttttaagccgaaaacccggaaaaaatccaaattttcagccgatcaaaaaccaaaaaaatcttatttttcagactagaaaagcctaaaaatcgccatttttcaggccatacgaaggccatctaatggatatgaagacccgaatgcttcttctaaatttcgatctcgaatcaatccgccgcgattctatgagattcttccagaatgcactacaaaccgacgtgcttctcctctatccaccgtcacagattgcactggccgccattaatttcgggctccatgctcagggtacggcgaagatctcgagaaatcgaaaattttgggagtttttgtgtaaaaattcgaattccccgtcatcgtattagtctaccctataagtttctgctaaaaatctcaaaatcccgtcaaattcggtgttttgggttactgtagcccgtgtttgcgtactctcggggctacagtaaccctggaaatttcaaaattgcgctagaaactccaaatgttcttcttttagagcggaatttgacaggaaatccgaatttcgctgtaaaattcctaaaattcgttgcgtaaagtgattttctagttttcaaaatttttgccaaaatttttgtgtaaaaattcgagctccccgtcatcgaattagtctaacacaaaaatttcagctcaaaatctcaaaattccgttaaatctggtgttttggggtactgtagcccgtgtttgcgtactcttggggctacagtaaccctggaaatttcaaaattgcgctagaaactccaaatgttcttcttttagagcggaatttgacaggaaatccgaatttcgctgtaaaattcctaaaattcgttgcgtaaagtgattttctagttttcaaaatttttgccaaaatttttgtgtaaaaattcgagctccccgtcatcgaattagtctaacacaaaaatttcagctcaaaatctcaaaattccgttaaatctggtgttccgtgtttgcgtactcttggggctacagtaaccctggaaatttcaaaattgcgctagaaactccaacttttcgtgtgctatagcagaatttcacggagaactcgaatttcagatttaagatccgaaaatctcaatttccgatagaaaaattcagcaattttgcactagtttcaggcaaatccgacgagattctacgcgagtttcttcggaaacttatcggaatcgaagaggac