Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y50C1_320.a   

sjj_Y50C1_320.aRNAiJA:Y50C1_320.a
PCR_productsjj_Y50C1_320.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY50C1A.1 Source_evidenceePCR422WS150 Sequence/Annotation Release
Overlaps_Gene Y50C1A.1 Source_evidenceePCR422WS150 Sequence/Annotation Release
Chunk_score Abs_score338
Max_abs_score338Y50C1A.1
Specificity_index0.531
Rel_score1
Map_statusUnique_ePCRI401370403868
Y39A3A.7 Chunk_score Abs_score115
Specificity_index0.181
Rel_score0.34
C13B9.1 Chunk_score Abs_score183
Specificity_index0.288
Rel_score0.541
Overlaps_transcriptY50C1A.1 Source_evidenceePCR422WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y50C1_320.a2499agcgtacttttgtacgtgggataaagaaaaaaaatatcaaaaaagatgaagtagaacttgagataaagacgaaaaactactttttcggaaaaaatttttttttggcaaaatggcattttttggccttttgttttatcacaactttttgccttttgcacttatgaactcaaactttctttcaaaaaatccacctctctgagtagtatcttgcacataaatttggaacaaaaccgagcaaaacccgaattttaattcaattaaaacatggttttttgggggtaaaaaaagcaacaaaaaattttttcaaactggggaaagccgccctgagctcagttttgctccaaactttgtgcagttttttgctcccccgtggggtgaaatatttctagtaagctgtcaaatattacaaaattcagtcaaacggctctggagttattaatgaaaacgcagtgtgacattttttcgcaagccaaaaaaaacgcgaaaaaacgcgaaaaaggggcggagtctgtacactcggcatttattagaggctgcttggcagattttgaaatatcggaaaaactttaaaagttcttttttttccaggacacctaaactggtggcatcaattcggccaaaaactctacccgctatcaactactggagacggaaattgccttcttcacgccgcatcgttaggtaaatggtttttcagagcgaaaaatcggaaaatcgctaaaaacttactatttccactgaaaaaattgtagagatcgctcaaaatttcactattttctgaacattttgataaaaaacgacaaaactatttcaaaacgagccccgaaaattgtttttttactaaattttttttggagaagtgcaaaaatttaaatttttgaattaaatctttaaatcttcaacaaaatttaatcgtaaattttcaggtatgtggggagtacatgatcgtcagctatcacttcgtgaaactctctacgaacttcttacaaatggcgccagaaaagaagcaatccgacggcgatggaaatgggttgagaatcatatgaatcaggtaattggcgagagaagaatctgtgaaaaatttcttaaaattcggtgaaaaatgatcaaaaatgagctgaaaaccggtcacgtagttgaaatccgcggaatatgaaattcccagaggaaacaattttcgtggatttcaacttcgcgaatttttctcaaaaagcttgagtaaaaactcacggagttgaaatccgcagaattcgaaattcccagaggaaacaattttcgtggatttcaacttcgcgaatttttctcaaaaagcttgagtaaaaactcacggagttgaaatccgcggaattcgaaattcccagagaaaacaattttcgtagatttcaacttcgcgaatttttctcaaaaagcttgagtaaaaactcacggagttgaaattcgcggaattcgaaattcccagagaaaacaattttcgtagatttcaacttttctagattttttgccaattttttattacatgttacaaaaaaacggctgtaaatactcacggagttgaaatccgcggaattcgatttttgtagatttcatcttttccagaattttccaacaaaaaaaaccggaaaaaattatccgacactccatggaatctagttttcggagatttcaacatcgagaacttttttcgcacatttttttgcatttttaaaaaatttcaccaattttccaattaaaattttttaaatttccagagtaacggtctcgcattgaccctctcggaaaatgaatgcttgagtaaaaactcacggagttgaaatccgcggaatttgaaattcccagagaaaacaattttcgtagatttcaacttcgcggagttttctgtcaattttttgagattttttctcaaaaagcttgagtaaatactcacgtagttgaaatccgcggaattcgagattccaggaaattcgattttcgtaaatttcatctttcccagaattttccaattaaaaaaaaacggaaaaaattatccgacactccatggaatttagttttcggagatttcaacatcgagaacttttctcgtagatttttttgcattttttaaaaatttcaccaatttttcaattaaaatttttttaaaaaattttcagagtaacggtctcgcattgaccctgtcggaaaatgaatgggaactcgaatgggatgttgtactcggattatcatctccattaccccgtaaacaagaggataatggctcaaattccacagatcaaatctacgagagtcttgaggcaatccacgtgttcgcgttggctcatgtgctcaaaagaccagttgtggttgtatcggatacggtagggaattttaaaattttttaattcttcaaaaatttattgaagagaacagtaacaaaaaatttggttacttgtgaattttacagaaatatagaaaattttaatttaaaaaaatttcgagattggtgagaatcaagggtgtcaagtc