Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y51H7C_255.b   

sjj_Y51H7C_255.b RNAi JA:Y51H7C_255.b
Simmer:Y51H7C_255.b:Repeat_a
Simmer:Y51H7C_255.b:Screen
PCR_productsjj_Y51H7C_255.b
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y51H7C.6c Source_evidenceePCR171WS150 Sequence/Annotation Release
Y51H7C.9 Source_evidenceePCR159WS150 Sequence/Annotation Release
Overlaps_Gene Y51H7C.6 Source_evidenceePCR393WS150 Sequence/Annotation Release
Chunk_score Abs_score351
Max_abs_score351Y51H7C.6
Specificity_index0.629
Rel_score1
Map_statusBest_ePCRII14083041409459
Y51H7C.9 (3)
Overlaps_transcript Y51H7C.9 Source_evidenceePCR159WS150 Sequence/Annotation Release
Y51H7C.6a.1 Source_evidenceePCR393WS150 Sequence/Annotation Release
Y51H7C.6a.2 Source_evidenceePCR393WS150 Sequence/Annotation Release
Y51H7C.6c Source_evidenceePCR171WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y51H7C_255.b1156tatcgccagatttgtgcttatttgacaaatgtggctggatggtcggcgcgggagaaagttggacggctgggacaggtaaaataaagaaaaatgaattattttgggtctgctaggctacaaactacacgaaatatttagcagacccgctctagaaattccaaaaaagttgagaaaaattggaaaaaaatggcaattttctcttgggtctgctagactacaaactacaaaagcctatttagcagacccacgccaacttctgatgggtctgctagactacaaactacaaaagcctatttagcagacccacgccaacttctgatgggtctgctaggctacaaactacaaaaaatatttagcagacccaactaatgtcttataaatttgggcctgctagactacaaactacaaaagcctatttagcagacccacgccaatttctgatgggtctgctagactacaaactacacgaaatatttagcagacccaacttccaatttttccagatcgtctccctcctcaacgtggaaactatcgacgaagcaatggaggtttggcataattcaaaagcgatgacgtcatcggcgacaattcgaactcttactctaccagaagtcagaaaagttctcgcgttacgagccgacttcccaactgtcgctattaaatctatcgaataattgtcgattaattaaattattctcttaaaatttccaattttattgatttttttgtataggaatatgtaaatttattaattgaattgtatgggtttcttctcaattggattgtgatttctatttttaaaaaaattattctaaaactcgaaattctgatattttatttttatttccgtttgttcaattttcaatgttgcatatctgatgttttatcaaagtcttggcaggcgattgttcttgaattggcagtttgacgggtcgtatctgaaagttttctctggtctgctaaatcgtgttgtgtagtttgtagtgtctggcagaccaaagaactcacacttcctggaacttctgcttcaactgcatttcgtgctcctctccgcgcacctcaatcaccatcttgacacgttgactcgacatgtcgtttctcatgaatgcacgttcctttaaattttatggttttttgctttaaaatgacggaaaaa