Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_Y51H7C_255.g   

sjj_Y51H7C_255.g RNAi JA:Y51H7C_255.g
Simmer:Y51H7C_255.g
PCR_productsjj_Y51H7C_255.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY51H7C.6b Source_evidenceePCR699WS150 Sequence/Annotation Release
Overlaps_Gene Y51H7C.6 Source_evidenceePCR1121WS150 Sequence/Annotation Release
Chunk_score Abs_score995
Max_abs_score995Y51H7C.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII14053661407605
Overlaps_transcript Y51H7C.6b Source_evidenceePCR743WS150 Sequence/Annotation Release
Y51H7C.6a.1 Source_evidenceePCR1121WS150 Sequence/Annotation Release
Y51H7C.6a.2 Source_evidenceePCR1121WS150 Sequence/Annotation Release
WB_DNA_textsjj_Y51H7C_255.g2240ttgtagcctagcagaccaaactcatttttcttcgattttcagcaagaaatctacgaaaaaatatcaaaaactattgattttgctcttaaatttgctattaaaacctgtttttaattaaaattgtggaaaaaatccccgatattggtctgctaaatcgaaattcgtagtttgtagtctagcagaccaaaattttcgttttaaaaaatgatttccagataatgaaagccggtggaaccgatgacaatcgtcgaaatgtcctctacgctgacactttgttcatgttctttgaaggagtcgccgagattattgaatcgaatcttccagtacttgaacactcgtacggcctggaaaagttgctggatttcatgtttattttgcaggtaaattcatcaaaaaatttaaaattcaaataattaaaaatcaaatttaatttaaaattttaataatttccaggcaagaattgacgagtttttccgacgccttcatgaagaattcgacacccgacgccgactttcccacttcaatcgccttgtcgatgacgtcattcatcagaaaaaagcagcggaagccgtcgaggatgctccagatccgatggaaatcgatgcgatagcttctgagatttgtatgatgaatacgtcggcggaaatgtattggagatttgtttctagaagaattgggaagaatgaagtgattagaagtccttctggagacggcgatgatgaggaaaacgaggaagctcggcaagaacgacacaggcttaggaaggaagctaaagagcagaaaatggatcagctgttaaatagaagccgtgttgggacgaaaatgcaggaattaattggcaattattgtcttttggagcatttttatatgttaaaatcggtacagaaggctataaaatccgatgtgaaagaggatgctggtggcttgacgaggtgcggagacaaaaaatatcgaaaaaggcccctaaaacaagaaaaaatatgttaaaaccgccagatttagctgaaatttgaaatttttaactttgttaacttgcagcagtatttattgaattttatgctaatttaggtacatttaaatacaacaaatacccaaaattcagcaaaattaacataaaaatcttataaactaccaaaatcacatgtgattaaaggtaataatcaatgaaatggagctgaaattagctaaaatcttgcattttgccatcttgcttattcaattatcgctatttactgcgtattccagtcgataaataccaaaaatactgaaaaaaaagcagtatttattgcatttttatggtaatttaggtacatttaaatacaagaactaccctaaattctcctaaatttacataaaaatcttataatttgaatgtttaaaaagcgaaaagttgacgattttttttaaatataaaaaaaggatatttaaaaaaaatagagaaatttttaattttttcccgaaaaaaacggaaaaaccggcataatttatactcaaattgtctaaaaaatgaagatttaacaaatttaaatcgaaattttacgattttttatgaaaattggagaaaaaacttattttaattaagataaatatgataaattcttcaaaaaatatattcctaaaaaatattttttaaaatcgacataatttacacacacaaaccagcaagcaaaattgaaatttcacaacgaaaatttacagaaaaaaacgaatttctgccaattttaagcctaaaaatccatatttccagctcaatcgtcgacgatgtggtgttcatcattcgaaaatcgatccgccgagctgcaggatccggcaatgttgatagtgtctgtgccaccattaacaacgccactgcactcatcgatacagtcgtccacgggcatttacgccagagcatccagcagggatacgtcacctcatccaatttcgcatctgaagcattcacggcttatcagcaaggaaaaccagtgaaggaggcggcggatgctcagaaggagcaatttttgctcgctctgaacaattctgcgaagctctccgagctgttgattgagcttcagaagggattgatcacggaatgggctggagtcaagcggcctgatgttgagaagaataagctcgagcattcgacgacgcaaattgaggagtcggcgaagaaattggccagtttggcgaagcatggggtggaggagctgtttaagagtgcatttaagaataagattaagcaagggtaggttttggactac